Mutations A point mutation or substitution is a genetic mutation where a single nucleotide base is changed, inserted, or deleted from a DNA or RNA sequence of an organism's genome. The following mutation occurred in the complementary DNA strand: TACTTACCTGGAATAATT

Mutations A point mutation or substitution is a genetic mutation where a single nucleotide base is changed, inserted, or deleted from a DNA or RNA sequence of an organism's genome. The following mutation occurred in the complementary DNA strand: TACTTACCTGGAATAATT

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Related questions

Q: A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a mutation…

A: Nonsense codon The mRNA sequences; UAA, UAG, UGA signals the termination of the process of…

Q: Which of the following strands of DNA always has the same sequence (except T-> U) as its…

A: In genetics,a sense strand or coding strand is the segment within double stranded DNA which carries…

Q: Which of the following sequences on a DNA moleculewould be complementary to GCTTATAT?a. TAGGCGCGb.…

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. It contains all genetic information that…

Q: From the previous question regarding the insertion of an A base into the template strand: will this…

A: The transcription is the process of RNA synthesis from the DNA template. It is the first step of…

Q: Given below is a DNA sequence as well as its corresponding mRNA and protein amino acid sequences.…

A: Mutation basically refers to the random change in the DNA sequence. These changes can result in a…

Q: mutation in a gene’s exons is more damaging than a mutation in a genes intron. Do you agree or…

A: DNA sequences consists of two parts exons and introns. Exon is that part of the DNA which directly…

Q: A section of DNA has the base sequence shown in #1. A mutation in this DNA strand results in the…

A: The mutation is the change in the nucleotide sequence of the DNA. There are several types of…

Q: A thymine is changed to an adenine in one DNA codon which causes a particular disorder. Which…

A: There are different types of mutations which involves- Deletion mutation, insertion mutation,…

Q: Coding strand of DNA, complimentary to the template strand 5' 3' A T G C T T G CA CATT G a GA A G A…

A: A molecule made up of two chains of a polynucleotide that generate a double helix by coiling around…

Q: A thymine is changed to an adenine in one DNA codon which causes a particular disorder. Which…

A: Mutation refers to the change in the sequence of nucleotides in a DNA molecule which acts as the…

Q: An insertion of two nucleotides into a gene results in a frameshift mutation. This statement is:…

A: The nucleotide sequences found within a DNA molecule are subject to change due to a phenomenon known…

Q: 1. Below is an amino acid sequence for the following strand of DNA: A G C A A T C C G T C T T G G T…

A: Ans 1 : Point mutation

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: point mutation (SNP) is sufficient to cause a genetic disorder if a. It causes a change at the…

A: SNPs (single nucleotide polymorphisms) are polymorphisms induced by point mutations that result in…

Q: During transformation a cell usually incorporates only one or afew fragments of DNA. Explain.

A: The prokaryotic organisms including the bacteria are single cell organisms. The genetic material…

Q: MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA…

A: Answer) The correct sequence of base pairs in mRNA would be - 5' AGGCACCAAAUAUGU 3'…

Q: When DNA is copied, sometimes a mutation occurs where an incorrect, base pairing appears within the…

A: Introduction :- Two nitrogen-containing bases (or nucleotides) that join to form the DNA structure.…

Q: Silent Mutations in DNA – Notice one nucleotide pair differs from the normal sequence given in…

A: In silent mutations, a nucleotide change can contribute to no change in the phenotype, i.e., the…

Q: If a nucleotide is replaced by a different nucleotide, this is called a(n)…

A: Here we will discuss different types of mutation based on the nucleotide replacement, addition and…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT…

A: A small section of a gene for a protein has the following nucleotide sequence that codes for the…

Q: Which of the following is not possible?a. A nonsynonymous mutation in an intronb. A nonsynonymous…

A: Nonsynonymous mutations are those mutations that can change the protein encoded by mRNA and are…

Q: Select the examples of mutation. A gene is copied twice during DNA replication. Several base pairs…

A: The change in DNA sequence of base pair results in mutation. It may or may not change the sequence…

Q: mutation are random change to the structure of gene. the likelihood of a mutation occuring can…

A: Mutation can be described as any sudden change to the DNA sequence. Mutation can alter the structure…

Q: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…

A: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…

Q: Some chemicals are known to cause mutations in DNA. EMS is a chemical that usually induces deletion…

A: Ethyl methanesulfonate is a mutagenic, teratogenic, and carcinogenic organic compound with formula…

Q: A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the…

A: DNA is the genetic material present in our body and RNA encodes for protein molecules. DNA and RNA…

Q: The antiparallel nature of DNA refers to its charged phosphate groups the opposite direction of the…

A: DNA strands are antiparallel to each other. They have different polarities to each other. One…

Q: What would be the effect on the gene product of a particular gene that had two separate mutations in…

A: Gene mutations are of various types such as Deletion Insertion Missense Non sense Silent…

Q: An RNA produced from a fragment of DNA has the sequence of 5'AAUUGGCU3'. The sequence of the…

A: Genetic information in our body is stored as DNA. DNA multiples itself by replication. DNA is used…

Q: mutations are the most common type of mutations accounting for the majority of all human genetic…

A: Mutation is a process by gene can be altered and lead to changes in the function of the protein.…

Q: Why are RNA viruses more likely to mutate than those that have genomes made of DNA? 2.What would…

A: Viruses generally have genetic material, either DNA or RNA inside a coat of proteins and…

Q: The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And…

A: mRNA Sequence: A U G U G G A A C C G C U G C U G A Amino Acid Sequence: METHIONINE…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand: 5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: A mutation in DNA that changes a glutamine codon, CAA, to a stop codon, UAA, is called a O…

A: Mutations can occur as a consequence of DNA copying errors during cell division, exposure to…

Q: a mistake in the genetic code at the start of a gene which changes EVERY AMINO ACID AF a change to a…

A: Mutation is a change in the nucleotide sequence of DNA which may or may not change the phenotype of…

Q: Which mutation that would result to a change of amino acid in the polypeptide? missense mutation…

A: When a DNA gene is destroyed or mutated in such a way that the genetic message carried by that gene…

Q: A G C A A T C C G T C T T G G T C G T T A G G C A G A A C C That strand has mutated. It is now A…

A: Mutation A change in the sequence of DNA bases that may or may not causes serious problem in an…

Q: Which of the following processes includes the removal of introns in the primary RNA transcripts? O…

A: Introns are noncoding sequences of an RNA transcript or the DNA encoding it. In simple terms,…

Q: anslation is synthesis of proteins from: t-RNA A. B. C. D. m-RNA r-RNA DNA 41. It is a type of…

A: *We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: A Section of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the…

A: \protein synthesis in a cell is a very important function. The information for protein synthesis is…

Q: A protein was mutated at amino acid position 129. Which of the following mutations will least effect…

A: All amino acids share different properties.

Q: A gene is a piece of DNA that codes for a protein. Genes are transcribed into MRNA and are on the…

A: The fundamental physical and functional unit of heredity is the gene. DNA is the material that makes…

Q: A certain template DNA strand has the following nucleotide sequence:…

A: Nucleotides can be described as the nucleic acids’ building blocks. The two forms of nucleic acid…

Q: A protein was mutated at amino acid position 129. Which of the following mutations will least effect…

A: The correct answer for this question is option- (d) R mutated to D

Q: An error in copying the DNA nucleotides during synthesis is called a _________________________. Most…

A: DNA (deoxyribonucleic acid) replication is a process of copying a strand of DNA. In this process,…

Q: At the DNA level, a mutation in a protein coding region where a single base is replaced by another…

A: Mutation is the abrupt change that occurs in the sequence of DNA resulting In altered phenotype.…

Q: which of the following statements accurately describes genetic mutations

A: 1. Mutation are natural process that increases genetic diversity. 2. Mutation in GAMETES will be…

Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…

A: INTRODUCTION Protein synthesis is the process in which the formation of new proteins takes place. In…

Q: Activity C: Genetic Mutations: A mutation is a change in the normal DNA sequence of a gene. There…

A: DNA is the genetic material present in most organisms and genes form the basic functional unit of…

Q: Such as in the case of sickle-cell disease, which of the following can occur from the mutation of…

A: Gene mutation is the change in expression of a gene which is caused by change in a single base pair…

Question

Having trouble with last 3 blanks. Please explain

Mutations
A point mutation or substitution is a genetic mutation where a single
nucleotide base is changed, inserted, or deleted from a DNA or RNA
sequence of an organism's genome.
The following mutation occurred in the complementary DNA strand:
TACTTACCTGGAATAATT.
Transcribe the mutated DNA sequence to mRNA AUGAAUGGACCUI and
translate it into amino acids AUGAAU GGA CCI
What is the effect of the amino acids?
resulted instead of
What kind of mutation is it?
« Previous
Next»

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
Compare the two DNA sequences shown below and consider the single nucleotide mutation made in the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: ATG CGC ТСС САТ стт ААС АAА GAG GTT GG C TAT TT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: АTG CGC ТСС САТ стТ ААС АAG GAG GTT GGC ТАТ ТТT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe missense nonsense frame-shift silent antisense
If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G
Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA, and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 3' TCACAATACAAAGGTGTACTGATCTCATCTCCATAA 5'
A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.
Compare the two DNA sequences shown below and consider the single nucleotide mutation made In the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: АTG CGC TСС САТ СТТ ААС AAА GAG GTT GGC ТАТ ТТТ Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: ATG CGC TCC CAT CTT AAC CAA AGA GGT TGG CTA TTT T Protein: Met-Arg-Ser-His-Leu-Asn-Gln-Arg-Gly-Trp-Leu-Phe- missense nonsense antisense O frame-shift silent
If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G
Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polyp
Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 5' ACCGAAGGACTTATGGAGCGCTCATGATTTGCT 3'
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
The following DNA fragment was isolated from the beginning of a gene. Determine which strand is transcribed, indicate the polarity of the two DNA strands, and then give the sequence of bases in the resulting mRNA and its polarity. CCCTACGCCTTTCAGGTT GGGATGCGGAAAGTCCAA