Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3 base pairs long. 17. AUG CAC UGU CcU UUC GCU GAC 18. GAG AUC UGG UUG GAA UCG 19. AGC GUA UUA ACG UAU CAU 20. AGU CGA UCG AUG CGG AUG AUA 21. GUC GUC GAU AGC UAU CAU GCA Transcribe the following DNA strand. Then translate the tRNA strand you wrote. 22. TGAGTCGACTGGCTGACCGTAGAC 23. CTTGGCTTATGGTGGTTCGCTCGC The following are pieces of MRNA. Give the DNA strand from which it was transcribed. 24. GAGAUCUGGUUGGAAUCG 25. AGCGUAUUAACGUAUCAU
Q: 8. The process of arranging organisms into similar or related groups, primarily to make it easier to...
A: Classification is the process in which the organisms are arranged into similar or related groups
Q: Certain proton pump inhibitors that inhibit secretion of stomach acid are among the most widely sold...
A: H2 blockers or histamine H2-receptor antagonists are drugs that minimize the acid production in the ...
Q: nucleoid ribosomes plasma membrane flagella lysosome mitochondria nucleolus prokaryotic only eukaryo...
A: Prokaryotic and eukaryotic cell share few similarities however show so many difference in their stru...
Q: Describe the bacterial colonies providing information on shape, color, size, elevation and edge appe...
A: *morphology of Escherichia coli is identified as rough or a smooth form. *The trough forms colonies...
Q: There are two broad classes of transposons. Each class is characterized by its method of "jumping" (...
A:
Q: 13) True or false: fragmentation spectra obtained from a mass spectrometer can help identify molecul...
A: Mass spectrometry is a technique for determining the mass-to-charge ratio (m/z) of one or more molec...
Q: What are the typical reactions observed when incubating lactic acid bacteria in litmus milk?
A: Because it includes the milk protein casein, the sugar lactose, vitamins, minerals, and water, milk ...
Q: How and why are avian and human muscles different?
A: Muscles are the the stretchy fiberes made up of soft tissue.
Q: If the code for an amino acid is ATG on the DNA molecules, this code on the transfer RNA molecule ma...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: DNA...
Q: A 22-year-old pregnant woman at 20 weeks of gestation comes to her OB/GYN for a scheduled prenatal e...
A: The correct option is B. ( 4-6 weeks )
Q: Homologous chromosomes_____ . a. are inherited from two parents b. are sister chromatids c. are diff...
A: Chromosomes are the structures that become visible during cell division only.
Q: A group of closely related strains, not all identical * a. class b. specie c. no...
A: A strain is a genetically different variety, a subtype within a biological species. Nomenclature is ...
Q: Two loci exhibit 5% recombination between them. How many map units apart are they?
A: Genetics is a branch of science concerned with the study of genes, genetic variation, and heredity i...
Q: What is transpiration
A: A complex traffic material is moving in different directions in a flowering plant, with each organ r...
Q: A collection of similar phyla or divisions * a. family b. order c. kingdom d...
A: 1. A collection of similar phyla or divisions- c. Kingdom Kingdom: In biology, a kingdom is the se...
Q: 3. Explain the movement of indirect protein transport; where are the proteins made, WHere Jie they g...
A: Mechanical protein digestion begins in the mouth and progresses to the stomach and small intestine. ...
Q: A “calico” cat (left) is mainly white with patches of black and orange fur. a. Almost all calico cat...
A: Introduction: Chromosomes are the condensed form of chromatin present in the nucleus of the cells. T...
Q: . You are provided with the DNA sequence in the leading strand template. See item number 1 in worksh...
A: DNA is a molecule that carries the genetic information for the individual.
Q: Answer and explain comprehensively. 3. If humans evolved from apes, then why are there still apes?
A: Apes meaning and explanation For much of history, people have used the terms "monkey" and "ape" inte...
Q: 21. Based on their shape and arrangement, identify the type of microbes.
A: Bacteria can be termed as group of prokaryotic, unicellular living beings that can be found in sever...
Q: Neuron Z has GABA receptors. TRUE FALSE Neuron Y is hyperpolarized by Glycine. TRUE FALSE Neuron Z h...
A: Neurotransmitters are termed as a body's chemicals signals and messengers.
Q: Select all the possible evidence that can be use to support the Theory of evolution 1. Fossil reco...
A: The process of organisms changing over time is known as evolution.
Q: The lumbar region is ________.a. inferior to the gluteal regionb. inferior to the umbilical regionc....
A: Vertebrae of a human spine is divided into cervical, thoracic, lumbar, sacral and coccygeal. Out of ...
Q: Which structure is highlighted? Multiple Choice saphenous nerve obturator nerve sciatic nerve and br...
A: Introduction Saphenous nerve:- it is the largest branch of the femoral nerve and innervates the medi...
Q: Dinosaurs like edmontosaur how do they defend themselves from predators like trex? Trex has most pow...
A: Paleontology is the study about fossils and it grouped the living things present at that time and th...
Q: It is the process where the parent's gene pairs separate.
A: Separation of different traits of the same gene or allele pair during meiosis so that they can trans...
Q: Maximal production of ATP from glucose involves the reactions of glycolysis, the citric acid cycle, ...
A: Cellular respiration is the process by which organisms utilize oxygen to break down complex food mol...
Q: 1. Reports about a man who successfully undergone xenotransplantation of a pig heart in replacement ...
A: Introduction :- Transplantation is method or process by which the cells , tissues , organs are trans...
Q: Homeotic gene expression _______. a. occurs via bacterial operons b. maps out the overall body plan ...
A: These are the genes which helps in the development of anatomical structures. Types of Gene Regulatio...
Q: Chromosome All possible chromosome configurations at diakinesis Mutation number wwm Monosomy Trisomy...
A: Aneuploidy occurs due to loss or gain of one or more chromosome.
Q: Analyze the following experiment and answer the questions that follow. Suppose that the growth behav...
A: Aquaculture is one of the leading animal-based food production sector in many of the countries. To o...
Q: True or False: The output of the Mass Spectrometer gives us the exact mass of a molecule.
A: The output of the mass spectrometer is the separation of molecules based on their m/z (mass to charg...
Q: Give the functions of the following bacterial structures. Cell wall Cell membrane LPS Ribosomes Nuc...
A: Bacteria are prokaryotic , ubiquitous microscopic structure which is one celled and is without any t...
Q: Which of the following processes involve random (chance) events?
A: The answer is all of the above. All the events as given,Genetic drift,Genetic recombination by cross...
Q: Dinosaurs like hardosaurs and others like duck bills if be hunter by predators what is their defense...
A: When a species goes extinct, it loses all of its genetic legacies. In order to adapt to environmenta...
Q: Hardosaurs like edmontosaur or others what ways they can defended against predators like tyrannosaur...
A: Dinosaurs have helped scientists comprehend the Earth and its history by allowing them to examine di...
Q: Which of the following characteristics of a water-insoluble substance is most important in governing...
A: The solubility in water of molecules is the tendency of molecules to gets dissolved in water. The ch...
Q: How you think the needs of societies in the past differ from what we need today. How can the differ...
A: Society is getting changed at a fast speed nowadays. Some changes in society are acceptable. while s...
Q: select the following answers
A: Since, individual 1(male a/c to the pedigree diagram) is phenotypically healthy and female 2 is dise...
Q: How is the shape of the bacteria related to it's function?
A: Coccus (spherical), bacillus (rod-shaped), and spiral (twisted) are the three basic bacterial shapes...
Q: Draw the molecular structures of the products obtained when 1-palmitoyl-2-oleoyl-3-phosphatidylserin...
A: Phospholipases are the enzymes which serves for different functions. Phospholipase A1 enzyme hydroly...
Q: You counted 40 colonies on a plate in your dilution series. The plate was inoculated with 1.0ml from...
A: A microbial sample will have enormous amount of cells. To estimate this by calculation, the sample i...
Q: Where is the proton-motive force generated in aerobic bacteria?
A: A proton-motive force is an energy produced by the movement of protons across the cell membrane and ...
Q: What is the maximum number of different alleles for a particular locus that can be present in a sing...
A: ANSWER: ALLELE- An allele is a variant form of a gene. and a gene is a sequence of nucleotides that...
Q: Which of the following characteristics of a water-insoluble substance is most important in governing...
A: Lipids solubility of a water insoluble substance play most important role in governing its diffusibi...
Q: eries of steps rat nuch to capture in s than would be r chan would be rel
A: The less total energy is released in multiple steps than would be released in a single step. Only a ...
Q: 3. The presented sequences are coming from one ancestral sequence. Through RE, the ancestral sequenc...
A: DNA sequencing is a laboratory technique used to determine the exact sequence of bases (A, C, G, and...
Q: An abundance of misfolded proteins in the ER can result in the activation of the unfolded-protein re...
A: Endoplasmic Reticulum can be referred to as one of the organelles of cell that can be observed in th...
Q: Mitochondrial oxidation of fatty acids is a major source of ATP, yet fatty acids can be oxidized els...
A: Introduction All cells require energy to survive and energy comes from respiration or metabolism. T...
Q: liver cirrhosis
A: The liver plays important physiological functions in the body, including detoxifying many substances...
Trending now
This is a popular solution!
Step by step
Solved in 8 steps with 4 images
- Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letter5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…1. The UAU and UAC codons in MRNA both specify What feature of the genetic code explains this? Second letter C UUU Phenyl- UUC alanine UAU UAC UCU Tyrosine UGU UGC Cysteine UCC Serine UCA UUA UUG UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan Leucine UCG CAU CÁC CUU CUC CUA CUG CGU CGC CCU CC CCA CCG Histidine Leucine CGA Arginine CGG Proline CAA CAG Glutamine AUU AUC Isoleucine A AUA AAU AAC Asparagine AGU ACU ACC ACA ACG AGC Serine Threonine AAA Methionine; start codon AGA AGG Arginine AUG AAG Lysine GUU GUC GAU Aspartic GAC acid GCU G GUA GUG GCC Alanine GCA GGA Glycine GGG GGU GGC Valine GCG GAA Glutamic GAG acid Chp 米 144 Third letter UCAG UCAGUCAGU CAG First letterThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly
- If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GIf DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- GAUU Isoleucine ACU AAU Asparagine AGU Serine U AUC Ile ACC |Threonine AAC AAA AAG Asn AGC Ser |AUA Methionine Lysine Lys AGA Arginine Arg ACA Thr A Met ACG AGG AUG Initiation codon GAU Aspartic acid GAC GCU GCC Alanine GCA GCG GUU GGU GỤC Asp GGC Glycine C G |GUA GUG Valine Val GAA Glutamic acid GAG Ala GGA Gly A Glu GGG G (a) What amino acid will a tRNA be carrying if its anticodon is GGG? Enter its 3-letter code. (b) What amino acid will a tRNA be carrying if its anticodon is UCC? Enter its 3-letter code. (c) What amino acid will a tRNA be carrying if its anticodon is UAU? Enter its 3-letter code. First letter ( Third letter
- 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutationThe sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?