Q: could you please draw this on an A4 paper using dots for the shading
A: This is probably a microorganism in a cullture media. The image can we clearly viewed under a…
Q: If the sequence in the coding strand of DNA for a particular amino acid is 5'AGT3', then the…
A: We all know that central dogma is a very important phenomenon in our bodies.In this process DNA gets…
Q: Which of the following does not happen at the O₂ binding site of hemoglobin (Hb)? 1) Movement of the…
A: Oxygen is important for every living organisms. To transport oxygen to the tissues, hemoglobin is…
Q: T-cell receptor diversity is controlled by __________ a. DNA recombination during…
A: There are two types of diversity that occurs in T cell receptors combinatorial and junctional…
Q: List two preparations shown every month by the uterus in anticipation of pregnancy in humans.
A: The systems in a woman's body that are connected to the development of an ovum for fertilisation…
Q: What is/are the characteristics of an ideal microscope?
A: Microscopes are instruments that help in getting a magnified image of an object. They are used to…
Q: What is the sequence of the protein that would be translated from the following mRNA molecule? Use…
A: Translation is the process in which cell make proteins by using genetic information carried in mRNA.…
Q: When can we say that HIV has progressed to the stage of AIDS? List several signs and explain why…
A: HIV or the Humans Immunodeficiency Virus is a virus that affects the immune system of individuals…
Q: Table 1. Average turgor loss point, stem hydraulic conductivity and plant water use efficiency for…
A: The average turgor loss point (TLP) is the point at which a plant cell loses its turgor pressure and…
Q: How do you think any one genera of Gnetophyta could be used to boost GUYANA'S plant industry?
A: Gnetophyta is a small division of gymnosperms that includes three genera: Gnetum, Welwitschia and…
Q: Please complete the table below. asap Types of hemodynamics Definition Causes Example 1.…
A: All these diseases are blood disorders. Hemodynamics measures cardiovascular functions related to…
Q: What structure does the proximal tubule lead to? O O intermediate tubule O glomerulus O distal…
A: In vertebrates,Kidneys are the main oragn which involved in excretion.In each kidney,there is…
Q: Ch. 6: The main imbalance in a patient with COPD is likely to be: a) respiratory acidosis. b)…
A: COPD - Chronic obstructive pulmonary disease (COPD) Is a disease caused by the inflammation of the…
Q: 4. The tension introduced into DNA by DNA helicase is relieved by: A. DNA polymerase B.…
A: Dear student, Since you have posted multiple questions, we will provide the solution only to the…
Q: List all the activities that should be included in a multicomponent exercise program for the…
A: A multicomponent exercise program or MCEP is an exercise program that combines resistance, balance,…
Q: Some non-plant organisms like the protist that spreads malaria contain a non-photosynthetic…
A: Protists are eukaryotic creatures that are neither plants, animals, nor fungi. Protists are…
Q: The answers may be used once, more than once or not at all. Deepest parts of the ocean, trenches…
A: Introduction Scientists believe that million of years ago, all continents were in the form a single…
Q: III OIV VII OVI Figure 1: Family pedigree tracing a genetic disease.
A: Inheritance pattern is a type of pattern which determines how traits are passed on from parental…
Q: pyramid. Explain this phenomenon. (c) An ecologist is doing an in-depth study of a tundra ecosystem.…
A: Given, Producer biomass per square meter is. = 3.5 kg/m2.
Q: Explain the relationship between PMI (postmortem interval) and post colonization interval.
A: Post mortem forensic report are highly important in determining the nature and time of death of the…
Q: Human embryonic stem cells are________. Plant cells are _____________.
A:
Q: Assume that the extracellular hydrophilic signal is acetylcholine. Describe the events that will…
A: G protein Coupled Receptor or GPCR are a class of membrane receptors that convert the extracellular…
Q: Explain the mechanisms for which the leaf water potential would be more negative at midday than at…
A: Water potential is defined as the potential energy of water in a system compared to pure water, when…
Q: Explain how a drug that blocks DNA recombination would affect the life cycle of HIV. Be as specific…
A: A virus causes HIV infection. By harming cells known as CD4 T cells, it targets and eventually…
Q: Excitable cells in the nervous system that generate and transmit electrochemical impulses are called…
A: The nervous system is the body’s control center and communication network. It consists of the brain,…
Q: Ch. 8: A fluid-filled cyst that occurs in the layers of the tunica vaginalis surrounding the testes…
A: Between the parietal and visceral layers of the tunica vaginalis, which immediately encircles the…
Q: Which statement describes tumor cells? A. Tumor cells acquire a drive to proliferate that does not…
A: New cells replace old ones when they die as a result of ageing or damage. Occasionally, this…
Q: What are the different controversies associated with biotechnological research and its resulting…
A: Biotechnology is the combination of natural science and engineering science. In biotechnology, a…
Q: list some important hormones produced by pituitary gland , testes, ovaries and pancrease and their…
A: Hormones are substances that primarily serve as messengers in the body. These compounds are released…
Q: explain any five challenges faced by adolescents in seeking sexual and reproductive health services
A: Introduction Adolescence is the phase of life where a person moves from childhood to adulthood.…
Q: What is cellular respiration? Answer in 2-4 sentences, including the words below: Glucose Oxygen…
A: INTRODUCTION This is a process by which the organism use oxygen for breaking down the food and…
Q: 14. Which of the amino acids below donates an ammonia group to every molecule of urea? a. Serine b.…
A: We all know that there is a continuous urea cycle occuring in our body.Some amino acids are also…
Q: The protein p53 is activated by a number of stresses on the cell, including DNA damage (as shown in…
A: Introduction:- Cancer or malignancy is defined as the abnormal growth of cells. The abnormal growth…
Q: apply the knowledge of imaging methods to understand techniques to visualise healthy and diseased…
A: Imagining methods are used for the visualization of internal structures of the body like organs,…
Q: The vp test looks for products of fermentation
A: Biochemical tests utilize the specific characteristics of bacteria to identify them accurately. Some…
Q: 5.Antimetabolites 5-fluorouracil and methotrexate are used for treatment of cancer. Explain the…
A: 5 fluorouracil and methotrexate are used as an anti cancer drug in chemotherapy. Chemotherapy…
Q: The ECL cell is stimulated to release_ OA. Histamine, Gastrin, CCKB O B. Gastrin, Histamine, CCKB…
A: Histamine, peptides derived from chromogranin A, including pancreastatin, and an unexpected but as…
Q: evaluate the relationship between the structure and function of DNA and RNA and how they encode for…
A: Both DNA and RNA both are nucleic acids. The difference arises in their sugars, RNA contains a…
Q: please list functions of glycoprotein
A: Antibodies are immunoglobulin (Ig) glycoproteins generated by plasma cells (B cells) in response to…
Q: 10. Which statement is true about gene transcription? A. Every gene that is present in the genome is…
A: Introduction: Transcription, is the process of the making an RNA copy of a gene's present on DNA…
Q: Ch. 8: Which of the following statements is FALSE about leiomyomas? a) They are also called uterine…
A: Leiomyomas, or uterine fibroids, are noncancerous growths that develop in and around the uterus.…
Q: Of the items listed, which is NOT a necessary life function? carbon dioxide maintaining boundaries…
A: Introduction Organisms need or must maintain a set of necessary life functions in order for them to…
Q: describe 10 different chemicals signals which can have a profound effect on eukaryotic cells
A: Eukaryotes are those organisms that contain specialized enveloped sub-cellular structures…
Q: alle 19 14. An organism which is positive for the CAMP test must be a(n) a. Group A Streptococci b.…
A: According to the question 14, Option (c) - Group B streptococci is the CORRECT answer. CAMP test is…
Q: Consider the sequence below for amplification: GGCGTAGGCTGATCGTGGGCTCTAGGGGGCTGCTGCTGCTATTATGCTGGC…
A: The polymerase chain reaction (PCR) is a molecular biology technique to amplify a DNA segment of…
Q: Plant B grows in unstable soil, it also needs to grow rather tall and grow quickly. This results in…
A: Roots are the most important part of a plant it grow under the ground and take water and food from…
Q: In superheroes, the gene for superstrength has two alleles. The dominant allele (S) codes for normal…
A: When an individual has two distinct allelomorphic forms (genes), only one of them, the dominant gene…
Q: T-cell receptor diversity is controlled by __________. Select one: a. DNA recombination during…
A: More junctional areas and more N nucleotide addition are responsible for the enhanced T-cell…
Q: Plant hormones
A: Introduction: Plants need a lot of natural support for their existence and growth, including water,…
Q: Consider the proper progression of the cell cycle. In one of the first steps, the __ Select one: a.…
A: e. nuclear membrane breaks down as the intermediate filaments dissolve. First of all first nuclear…
Can I please get help on the last bullet point for the first question: "Do concussions cause memory loss?" And the first 2 bullet points of the second question starting with: "Researchers are studying..." and ending with "A study tracks the long-term..."
Step by step
Solved in 3 steps
- OBJECTIVE & SCOPE OF THE PROJECT The scope of the project is to prediction of crops can be informed to agriculturists in time basis. Many Machine Learning techniques have been used to analyse the agriculture parameters. Some of the techniques in different aspects of agriculture are studied by a literature study. Blooming Neural networks, soft computing techniques plays significant part in providing recommendations. Considering the parameter like production and season, more personalized and relevant recommendations can be given to farmers which makes them to yield good volume of production. Q.CONVERT THE ABOVE SENTENCE'S WHERE OBJECTIVE SHOULD BE GIVEN AS POINTS AND EACH POINT SHOULD START WITH A VERB? OSituation: A student is planning to conduct a research related to the effects of pulverized mango rind on the growth of tomato plants. Specify the dependent, independent and controlled variables in the given situation abovediscuss the major biochemical and physiological considerations the acclimatization of in vitro derived planting materials
- Part 2: Assume that there is a nonzero average causal effect of soil fumigants on crop yield. In no more than 3 sentences, describe a setting, in terms of relationships between soil fumigants, eelworm cysts, and crop yield, where evaluating the mean difference in crop yield between treated/untreated fields with the same level of eelworm cysts would not produce a biased estimate of the causal effect of soil fumigants on crop yield. You do not need to provide numerical examples, just describe relationships among the fumigants, cysts, and yields.Chronic exposure to neonicotinoids reduces honey bee health near corn crops Experiments linking neonicotinoids and declining bee health have been criticized for not simulating realistic exposure. Here we quantified the duration and magnitude of neonicotinoid exposure in Canada's corn-growing regions and used these data to design realistic experiments to investigate the effect of such insecticides on honey bees. Colonies near corn were naturally exposed to neonicotinoids for up to 4 months - the majority of the honey bee's active season. Realistic experiments showed that neonicotinoids increased worker mortality and were associated with declines in social immunity and increased queenlessness over time. We also discovered that the acute toxicity of neonicotinoids to honey bees doubles in the presence of a commonly encountered fungicide. Our work demonstrates that field-realistic exposure to neonicotinoids can reduce honey bee health in corn-growing regions. Which of the following…Instruction: Interpret the data given in the table below. Explain your answer. (Flooding of transplanted wetland rice for weed control) Water Regime Number of weed seedlings per 50 cm x 50 cm Drained 10 Flooded 3
- In this experiment, answer the following questions: 1. How do you measure the energy produced in this experiment? 2. Will you be able to perform the same results (flask A with germinated seeds temperature increases and flask B with boiled seeds temperature remain unchanged), assuming you will be using a regular glass flask? Why? 3. How come the (boiled seeds) control set up release energy as well? How come even if the boiled seeds here are considered dead they still release energy? 4. Is it possible of getting the reverse of the results. If yes, why?Explain the terms anthropometry and biomechanics and why they are important in relation to safe design principles to control WHS risk?Prediction versus hypothesis Homework • Unanswered Which of these is a prediction Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a When planted alongside garlic buds, strawberry plants are bug-free If garlic buds deter bugs that attack strawberry plants, then strawberry plants that are planted alongside garlic buds will host fewer bugs than those strawberry plants that are planted on their own
- Review A farmer wishes to develop a strain of high-yield corm that is also resistant to drought. He has the following individuals from the current year's crop: Individual A-Yield: 179 bushels/acre; drought resistance: high Individual B-Yield: 220 bushels/acre; drought resistance: low Individual C-Yield: 185 bushels/acre; drought resistance: medium Individual D-Yield: 140 bushels/acre; drought resistance: high Individual E-Yield: 200 bushels/acre; drought resistance: medium Which of the following crosses would produce the highest corn yield with the highest resistance to drought? v View Available Hint(s) Hint 1. Determine the average yield and drought resistance expected from each cross. B and B A and B C and E A and E Submit Request Answer (P Pearson O O O OFor the article "Effects of an invasive predator cascade to plants via mutualism disruption" (https://www.nature.com/articles/ncomms14557) answer the following points: - What was the question addressed by the author(s)? What was the author's hypothesis? - Overall, what did the author physically do, use, and/or document to test the hypothesis? - Summarize the results.Write a hypothesis for each of the following research problems 1. What effect does light have on plant growth? Hypothesis: