Please fill out the following table. Circle sense or template strands. Indicate 5’, 3’, amino and carboxy ends. Usewobble whenever possible First letterUAUUCUบบบาUUCJUUAUCCUCAUUG Leu UCGJCUUCUCCUACUGGUUGUCPheGUAGUGJLeuSecond letterсAAUUACUAUC IleACCAUAACAAUG Met ACGValCCUCCCCCACCGGCUGCCGCAGCGSerProThrAlaUAUUACTyrCUGC CysUAA Stop UGA Stop AUAG Stop UGG Trp GHisCAUCACCAACAGGInGAUGACGAAGAGGAspGluCGUCGCCGACGGAAU AsnSerАААAAGLys AGG ArgAGUAGCArgGGUGGCGGAGGGGlyUCAC DUAG DUAGThird letterсАGАUсА DNAsense ortemplateDNAsense ortemplatemRNAtRNAprotein5', 3'amino orcarboxyl5'A|CACUST TE RTG5', 3'amino orcarboxyl3'

Name: Please fill out the following table. Circle sense or template strands.
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Please fill out the following table. Circle sense or template strands. Indicate 5’, 3’, amino and carboxy ends. Usewobble whenever possible First letterUAUUCUบบบาUUCJUUAUCCUCAUUG Leu UCGJCUUCUCCUACUGGUUGUCPheGUAGUGJLeuSecond letterсAAUUACUAUC IleACCA

Three subsequent nucleotides present in the mRNA are known as the genetic codon. Their are total of…

Answered: Please fill out the following table.…

Science

Biology

Please fill out the following table. Circle sense or template strands. Indicate 5’, 3’, amino and carboxy ends. Use wobble whenever possible

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 9P: Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram...

See similar textbooks

Similar questions

EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
What is thee tRNA anticodon for the first 5’-ACGAUC-3’?
With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the sequencce of RNA in which the protein product will be detrnemined. -What will be the protein product sqeuence? -What will be the pl of the protein product?
TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that would be formed by translating this plece of DNA. You can use the three letter abbreviations for the amino acid in each box, do not use the name of the full amino acids, Use the abbrevlation of the amino adid exactly as Itswritten in the table (including the appropriate capltalizations For example it your answer for amino acid 1 is"Methionine" you would write MET in the box (not Met or met) Second Later UUU UUUC Phe UCU UAU Ser UAC UAA UAG Tyr UGU Cys U Leu UCA ucG UGC Stop uGA Beop UUG Step UGG Trp G Cuu C cuC CUA CUG CU Leu Coc CCA CG CAU Pro cGu CAC CAA CAG His CGC Arg CGA CGG 1st 3rd letter AUU A AUG AUA AUG ACU le AAU AAC AGU ACC Asn Ser U leBer ACC ACA Mct ACG The AAA AAG ACA Lys AGG Arg acu Val GCC GCA GCG GAU GAC GAA GAG GOU GGC GGA GGG Arp G GUC GUA GUG Ala Gly Glu Seovence of the protein, 1st amino acid. 2nd arnino acid: 3rd amino acid: 4th amino acid Sth amino acid: 6th amino acid: 7th amino…
Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.
Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…