please identify structure information about this gene which is adgrg1/gpr56. You can identify anything about the molecule including chains, atoms, etc.
Q: In which phase of meiosis are the pairs of homologous chromosomes (tetrads) lined up along the…
A: The meiosis is the cell division process that involves division of a diploid (2n) mother cell that…
Q: Compared to high latitude relatives, low latitude organisms tend to have higher surface area to…
A: Bergmann rule According to Bergmann's rule, the species that are found in higher latitudes have…
Q: Microbes can be used to decrease the use of chemical fertilisers and pesticides.Explain how this can…
A: Introduction In this question we will discuss how microbes can be used to decrease the use of…
Q: What causes monosomy and trisomy disorders? deletion insertion translocation O non-disjunction
A: Monosomy and trisomy- Monosomy = It is the type of aneuploidy when only one chromosome of a pair is…
Q: Phosphorylation of elf-2 regulates eukaryotic protein synthesis initiation by inhibiting formation…
A: In mammalian cells, mRNA translation is continuous and one of the first mechanisms that control the…
Q: Question 19 Listen Aminoacyl-tRNA synthase recognizes their specific amino acid by and A ; they…
A: Aminoacyl tRNA synthase is also known as tRNA ligase. It loads or charge the tRNA with specific…
Q: Explain logistic growth, carrying capacity, limiting factors,and other fundamental concepts in…
A: An ecosystem is made up of the living and nonliving components of a habitat that interacts with one…
Q: what is Rhabdomyolysis how it causes actue kidney injury?
A: The Urinary System is a collection of organs in the body that filter excess fluid and other…
Q: Q What is sewage? In which way can sewage be harmful to us?
A: Introduction In this question we will discuss about the sewage.
Q: 2. Explain the difference in the use of a centrifuge and a thermal-cycler.
A: Ans 1 The main use of a centrifuge machine is separating contents of fluids on the basis of their…
Q: What will happen to a cell if Phagocytosis does not occur in the Endomembrane system?
A: INTRODUCTION Cell organelles or different compartments such as the nucleus, Golgi body, ER, and…
Q: AAAC G CA G CCG Phe Gly Arg
A: In this image, we are shown the formation of proteins from DNA by following the central dogma of…
Q: 32. What are the main components of the cytoskeleton?
A: * cytoskeleton is the complex and dynamic network containing the interlinking protein filaments in…
Q: Sequence of amino acids in protein
A: Protein Synthesis: It is the process of creating protein molecules. There are 5 major steps involved…
Q: What is one difference between fermentation and anaerobic respiration? Since neither requires…
A: Respiration There are three types of processes of oxidation of food substrates in different…
Q: A muscle biopsy is taken after 12 days of heavy strength training. The muscle cells appear to have a…
A: *Muscle biopsy is a procedure to diagnose diseases of muscle tissue. Healthcare provider will remove…
Q: 1) Write your dilutions as a rational number AND in scientific format? What was your total dilution…
A: Serial dilution is a process in which a sample is taken and diluted through a series of standard…
Q: 2 6. 89 10 11 12 13 14 15 16 17 18 87 20 .. .. 19 20 21 22 There is only one pair of in this…
A: This is the karyotype which gives the detailed number and structure of the chromosomes present in…
Q: What does it mean when systems are linked, and how closely do they resemble one another?
A: Linked genes sit close together on a chromosome, making them likely to be inherited together (left).…
Q: Identify and discuss the main muscle groups needed to perform 400 meter event.
A: Energy method and muscles used in 400 m race
Q: True or False: Neurotransmitters have different shapes.
A:
Q: Cell Line Mutation WT none (wild type DNA) 1 a deletion at the same region on both copies of…
A: A cell line refers to the cell population that proliferates from a single type of cell under…
Q: If one strand of DNA has a sequence of TCAG, then the sequence of bases on the complementary strand…
A: DNA is double stranded where the two strands are antiparallel and follows complementary base…
Q: Question 3 If a person's respiratory minute volume increases, how will this affect the blood's pH?…
A: ANSWER) With the increase in person's respiratory minute volume the pH of the blood will also…
Q: 6 what is the letter that show the part that house DNA? 7. Cell (plasma) membrane is labeled with
A: * cell membrane separates the internal environment of cell from the outside environment. *The cell…
Q: Determine whether each statement is TRUE or FALSE. a. In eukaryotic chromosomes, DNA replication…
A: The heterocatalytic process by which a new DNA stand is synthesized on a old DNA template, is known…
Q: Placing bacteria onto the medium in a Petri dish is known as
A: Bacteria are the unicellular prokaryotic organism. Bacteria belongs to the kingdom Monera. Bacterias…
Q: In pea plants, P is purple flowers, p is white flowers, T is tall plants, and t is short plants.…
A: Introduction : A dihybrid cross describes a mating experiment between two organisms that are…
Q: How would you scientifically define the three things that emerge in a chemical reaction? 2.…
A: Early chemists regarded substances isolated from organisms (plants and animals) as a different type…
Q: Is Crohn's disease considered as an autoimmune disease. If it is, are there other predisposing…
A: Chron's disease and it's linkage
Q: Do different genes affect epigenetics and variations in epigenetic patterns between individuals?
A: Genes patterns
Q: Give other examples and uses of animal movements
A: Creature motion, in ethology, is any of an assortment of techniques that creatures use to move from…
Q: Radiometric dating and the cranial capacity measurements are back from the paleolab for the specimen…
A: Introduction Osteology is a branch of anatomy that deals with the study of bones. The body skeleton…
Q: Explain pulmonary and Aortic circulation in man.
A: Introduction The circulatory system is the system that contains the heart and the blood vessels…
Q: Ladder Lane 1 Lane 2 Lane 3 Lane 4 Lane 5 Lane 6 Lane 7
A: SDS-PAGE Sodium Do-Decyl Sulphate- Polyacrylamide Gel Electrophoresis It is a molecular technique…
Q: How do you use CRISPR to treat a patient with sickle cell anemia? Please provide a detailed…
A: In sickle cell anemia the blood cells become sickle shaped. This may result into painful blood flow,…
Q: Question A virion is a single virus particle outside of a cell. It contains genetic material in the…
A: Answer : genes a virion contains are : 5 150 A virion has enough genetic information to code…
Q: In upper gastrointestinal bleeding, without knowing the cause or source of bleeding, why do we give…
A: The Role of Proton Pump Inhibitors in the Management of Gastroesophageal Reflux Disease…
Q: 2. In 1665 Robert Hooke, an English scientist, published his book Micrographia, in which he…
A: Eukaryotes are the organism whi h comprises of true nucleus and membrane bound organelles. It…
Q: 1. What happened to observed allele frequencies in each population? (only answer this question…
A: The frequency of an allele in a population is measured by its occurrence. Allele frequency can be…
Q: What are the various routes by which transmission of human immunodeficie virus takes place?
A: Human immuno deficiency virus causes AIDS that is acquired immuno deficiency syndrome. It is a…
Q: Question 5 Eukaryotic transcription regulators can control transcription initiation away from the…
A: Transcription is the process of RNA production from the DNA template that occurs within the nucleus…
Q: 2- Describe in details structure and function of Nucleus, endoplasmie reticulum, and Golgi apparatus…
A: Nucleus :- It is enclosed in a phospholipid bilayer also known as Nuclear Envelope and has pores…
Q: Research evidence showed that microbial species and bacteria could be found in bottled water. In…
A: Since you have asked multiple questions will we will solve the first one for you According to the…
Q: Assuming normal anatomy, which of the following landmarks is appropriate for gaining subclavian…
A: The correct option is C.
Q: 2. Write the MRNA transcript from the DNA template in question 1. Remember your enzyme for RNA…
A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…
Q: According to the clonal selection theory, all immunoglobulin molecules in an individual B cell have…
A: *clonal selection theory states that antigen selects lymphocytes for activation from some cells to…
Q: Consider the homozygous mutation in which a cell produces a variant of adenylate cyclase that can no…
A: Adenylate cyclase (also known as adenylyl or adenyl cyclase) is an enzyme that catalyzes the…
Q: Tall is dominant to short and green pods are dominant to yellow pods. If you cross plants with the…
A: Genetics is the study of the functioning and main codes of variation and heredity. Inheritance is…
Q: One gene for an eye color in dogs is sex linked (X chromosome). The dominant allele (G) produces…
A: "Genetics" is the study of the functioning and main codes of variation and heredity. Inheritance is…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
please identify structure information about this gene which is adgrg1/gpr56. You can identify anything about the molecule including chains, atoms, etc.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucineThe BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINYBelow is a short nucleotide sequence from a gene. Use the Internet(e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what genethis sequence is from. Also, determine the species in which thisgene sequence is found. 5’–GGGCGCAATTACTTAACGCCTCGATTATCTTCTTGC GCCACTGATCATTA–3’
- We have talked about several examples of cis-acting elements that have dyad symmetry (inverted repeat symmetry). Some function on the level of DNA, and others function on the level of RNA. Give one example of one that functions at the DNA level and briefly explain why the sequence requires dyad symmetry to work properly. Note: you don't have to give an exact sequence, just the name of the element. Edit View Incort Format Tools Tablo5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutationRepresentations of sequencing chromatograms for variants of the a chain of human hemoglobin are shown here. Match each of the variants with the corresponding amino acid change. You can use the codon table to decode each amino acid sequence. For example, the first triplet encodes for Val. Normal Chongqing ddATP ddCTP ddGTP ddTTP Pro to Thr Gly to Asp Leu to Arg Karachi Swan River Answer Bank Ala to Pro Asp to Gly Pro to Ala Arg to Leu Asp to Asn Arg to Val
- The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of glutamate during translation of a hemoglobin chain. Using the table of codons below, determine the mutation in DNA that produces this disorder. 1st position ✓ U C A G Select one: U C serine phenylalanine phenylalanine serine leucine serine leucine serine leucine leucine leucine leucine isoleucine isoleucine isoleucine methionine Table of mRNA Codons 2nd position valine valine valine valine proline proline proline proline alanine alaninc alanine alanine A tyrosine tyrosine a. CUC changes to C AG b. GAA changes to GUU c. CTT changes to CAT d. C A G changes to CTC stop stop threonine asparagine threonine asparagine threonine threonine histidine histidine arginine arginine glutamine arginine glutamine arginine lysine lysine G cysteine cysteine stop tryptophan aspartate aspartate glutamate glutamate serine serine arginine arginine glycine glycine glycine glycine 3rd position DCMO U С A G U C A G…As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'
- The Universal Genetic Code Table can be used to determine the gene product of a given nucleotide sequence. Universal Genetic Code Table Second Letter A G UUU } Phe UCU UAU } Tyr UGU } Cys UUC UCC UAC UGC Ser UUA } Leu UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG Trp CUU CAU CCU CCC CGU } His CUC CAC CGC Leu Pro Arg CUA ССА CAA CGA } Gin CUG CCG CAG CGG AGU } Ser AUU ACU AAU } Asn AAC AGC AUC A AUA Ile ACC Thr ACA AAA AGA } Lys } Arg AUG Met ACG АAG AGG GUU GCU GAU GGU } Asp GUC GCC GAC GGC Val Ala Gly GUA GCA GAA GGA } Glu GAG GUG GCG GGG The table below represents the transcription of a short peptide sequence in a human cell. Place the amino acid abbreviations that correspond to the nucleotide sequence when it is translated. DNA TTG CTG TGT GAG GCA MRNA AAC GAC ACA CUC CGU Protein (реptide sequence) :: Ala :: Arg : Asp :: Asn :: Сys : Gln : Glu : Gly :: His : lle : Leu : Lys : Met : Phe :: Pro :: Ser :: Thr : Trp : Val Third Letter First LetterFor the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAGhttps://drive.google.com/file/d/1fOtSuZ_NNdi7qRXHCkM6mtvwRS0pl8u6/view?usp=sharing Compute the [A + C]/[T or U] +G] ratios of the DNA and RNA models in Figure 1. Do you expect the same values for other DNA and RNA models that will be constructed for instance? Why?