Please provide ingredients and process on how to make DRIED MANGOES products

Q: The four key attributes of community structure are total number of species top-down and bottom-up…

A: total number of speciestrophic cascadesthe sum of interactions among all speciesspecies relative…

Q: What is biology

A: Science is defined as any defined knowledge system that deals with the physical world and its…

Q: Below are the reduction half reactions for chemolithoautotrophic denitrification, where hydrogen is…

A: The question address the process of the chemolithoautotrophic denitrification, where the  hydrogen…

Q: Part A Chemical reactions that release energy are called exergonic. energetic. endergonic.…

A: Living organisms shows metabolic properties. Different metabolic reactions occur within the living…

Q: the Phospholipid bilayer below to diagram what steps occur during both the Photosystem 1 and 2. ke…

A: Photosynthesis is a process by which green plants prepare their own food with the help of carbon…

Q: 4. Which term describes the cell membrane potential of a neuron at rest? a. polarized  b.…

A: The neuron is an excitable structure, its function is to receive and transmit various stimuli in the…

Q: as an avid advocate for the adoption of ethical codes in sport, provide a description of usa cylist…

A: In highly competitive sports, athletes sometimes use performance-enhancing substances. Using such…

Q: Part I: 1. What similarities or connections can be seen between these seven individuals? 2. What…

A: Disease is a condition that put negative impact on an individual ' s body and disturb the normal…

Q: Bascillus bacteria is of which shape? a- rod shape b- spring like c- circle shape d- oval shape

A: Small, single-celled organisms called bacteria exist. Nearly all areas of the world are home to…

Q: excitatory and 15 inhibitory postsynaptic potentials appear simultaneously on the plasmatic membrane…

A: EPSP is the excitatory postsynaptic potential. This is the graded potential whose function is to…

Q: Controls the outputs of the cortex and regulates motor activity. Central pattern generators.…

A: The segmental level refers to the neural processing that occurs at the level of the spinal cord. It…

Q: What is this formula and how is it derived?? This was used in an experiment related to the screening…

A: Various analytical techniques are used to examine the amounts of carotenoids in biological…

Q: Viruses cannot be grown in standard microbiological culture such as broth and agar. They need to be…

A: Studying viral behavior, developing vaccines, and performing diagnostic tests are all made easier by…

Q: 2. Consider the following reaction. What is the consequence of the increase of cytosolic CAMP…

A: During "fight or flight" response, heart rate and blood pressure increases. This means breathing…

Q: Question 6 Which of the following is/are necessary for natural selection to occur in a population of…

A: Natural selection is a fundamental mechanism of evolution that drives the adaptation of populations…

Q: Which of the following statements is true? Multiple Choice   The human body normally uses very…

A: The physical framework that comprises the numerous systems and chemicals that constitute a human…

Q: ✓ Treatment with high concentrations of micrococcal nuclease (Mnase) ✓ Low Salt ✓ Absence of Histone…

A: Eukaryotic DNA (except in dinoflagellates) remain associated with histone protein and form a…

Q: In oxygenic photosynthesis, microbes such as Cyanobacteria use light energy to produce oxygen by…

A: a) Water is a critical component of oxygenic photosynthesis because it is the source of electrons…

Q: Ester Lederberg's discovery of the lambda phage and F-plasmid were significant because: (select all…

A: The lambda phage is a bacteriophage that infects bacteria, specifically Escherichia coli (E. coli)…

Q: What are some unique complications that can arise during specific life stages in organisms, and how…

A: Every organism goes through different life stages, starting from birth, growing into adulthood,…

Q: A population of bats exhibits logistic growth. The carrying capacity is 600 bats and the maximum per…

A: Logistic growth is a type of population growth pattern that occurs when a population initially grows…

Q: Prior to subculture, Tifa used a hemocytometer to count her HepG2 cells cultured on a T-25 flask.…

A: In the field of cell culture, accurately assessing the viability and concentration of cells is…

Q: A suspected pathogen is observed from the blood of a diseased mouse. An investigation of the other…

A: Koch's postulates are a set of rules for proving a connection between a suspected pathogen and a…

Q: Compare and contrast semelparity and iteroparity.  How does this differ from determinant and…

A: One of the fundamental biological processes that take place in living things is reproduction. In…

Q: For a cell that must take up acetic acid from its environment, will uptake of the charged form…

A: The membrane of cells is the outermost layering of the cell that separates the internal cellular…

Q: 4. Choose a statement that best correctly characterizes membrane-bound ribosomes. a. Bound…

A: The correct statement that characterizes membrane-bound ribosomes is: c. Bound ribosomes generally…

Q: I was given a graphing activity.  It was do with the measuring the reaction rate against…

A: Question 2- As depicted in the graph when all the points are joined in the graph, the value of…

Q: Question. Regarding animals cells, list what you consider to be the top 4 most important organelles…

A: Mitochondria are responsible for cellular respiration producing energy in the form of ATP through…

Q: True or False: The traits of individuals who produce more surviving offspring spread through the…

A: Traits are observable characteristics or attributes of an organism that can be inherited and passed…

Q: Give a short explanation to this

A: ETHICS OR MORAL PHILOSOPHY IS THE BRANCH OF PHILOSOPHY THAT INVOLVES SYSTEMATIZING, DEFENDING, AND…

Q: Answer true or false for each of the following statements: a. Inbreeding tends to reduce the ability…

A: The following statements require a true or false response, and each statement has its own context…

Q: Match the function with the bacterial structure. Swimming motilty Twitching motility Conjugation…

A: As immensely diverse creatures, bacteria have a variety of structural modifications that allow them…

Q: Are there specific E. coli strains used to make competent cells? Explain the characteristics of…

A: Competent cells are the bacterial cells which take up foreign DNA by the process of transformation.…

Q: What is lignin and its role in plants? Why can reducing the amount of lignin in trees enhance the…

A: Note:- Sticking to our guidelines I have answered only ist three questions. Please ask rest of the…

Q: 3. Chemical X inserts channels into bacterial cell membranes. Rhodospirillium, a purple non-sulfur…

A: Photosynthesis is a pathway by which all plants and some bacteria produce energy by utilizing carbon…

Q: nvestigate the changes in taxonomy since Linnaeus. Note major changes, such as the recognition that…

A: 1)The field of taxonomy, which involves the classification and categorization of organisms, has…

Q: Determine whether the expression of wild type lacZ and lacy would be “inducible,” “uninducible” or…

A: A genotype refers to the genetic makeup or combination of alleles present in an individual or…

Q: A newly discovered microorganism has been studied and is being called a chemolithoautotroph. Dissect…

A: "Chemo" refers to chemicals and "litho" refers to rock or inorganic compounds. Therefore…

Q: Study the sequences below. Construct a molecular cladogram from the different amino acid sequences…

A: The phylogenetic tree and the molecular cladogram are both important tools in molecular biology and…

Q: Species C: ATGTTCGCCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTA…

A: By submitting your query sequence to the chosen database, do a BLASTn search. By comparing your…

Q: 24. Only 30% of adult humans can hydrolyze lactose. Unlike their lactose-intolerant fellow humans,…

A: The ability to digest lactose, the sugar found in milk, varies among adult humans. Approximately 30%…

Q: Refer to the experimental approach (i.e., very briefly describe) and give the results AND…

A: A short RNA molecule called a microRNA, or miR-145 is involved in the post-transcriptional…

Q: Which of the following is an example of bioremediation? using a bulldozer to regrade a strip mine…

A: Bioremediation is the use of living organisms, such as bacteria, fungi, or plants, to break down or…

Q: Gastric juice acidity is increased in a patient. Answer the questions A and B: A) How and why will…

A: Gastric juice refers to the acidic fluid secreted by the gastric glands in the stomach. It plays a…

Q: Wolves Elk Willow Trend in population size or amount of growth Explanation for this trend

A: A trophic cascade is an ecological phenomenon in which a population in the food chain reduces…

Q: Which of the following statements is TRUE? Log cell numbers Time a) The generation time for bacteria…

A: The image depicts bacterial growth curve. It consists of four phases of growth. they are lag phase,…

Q: Create a dichotomous key using the genera/species: Mycale laxissima, Halichondria poa, Amphimedon…

A: A dichotomous key based on the provided genera/species and their characteristics:Growth form:…

Q: Part II: 1. Recalling your knowledge of the function of organelles, what function of the cells was…

A: Autopsy is one type of examination on death body by which we can found the cause of death.…

Q: 3. (a) Comparing the culture-dependant (e.g., colony forming units count) and DNA- based (e.g., PCR)…

A: Wastewater treatment is the process of removing contaminants and pollutants from wastewater to make…

Q: ditions but they are not sure which one. researchers determine the movement of three different ions…

A: Rod which is the photoreceptor pigment has two segments the inner and Outer segment. The inner…

Industrial Processes

Industrial processes result in the manufacturing of products (biological products, such as enzymes, medicine) on a large scale using different methods, such as physical and chemical procedures. Few products such as pharmaceuticals, agricultural products, food items, etc., involve microbes and their enzymes. Such processes are termed industrial biological processes. Microbiology and biotechnology enable us to utilize the ability of microorganisms to produce enzymes, primary metabolites, and secondary metabolites, which in turn help to produce the desired products.