Problem 3: Nitrous acid causes all possible transition mutations, CT and G A. If the normal sequence of a protein contains a valine residue (val) at a particular place, what new amino acid(s) would most often appear in place of the valine residue as a result of nitrous acid mutagenesis? Use a codon chart.

Problem 3: Nitrous acid causes all possible transition mutations, CT and G A. If the normal sequence of a protein contains a valine residue (val) at a particular place, what new amino acid(s) would most often appear in place of the valine residue as a result of nitrous acid mutagenesis? Use a codon chart.

Name: Problem 3: Nitrous acid causes all possible transition mutations, C T
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Problem 3: Nitrous acid causes all possible transition mutations, C T and G A. If the normal sequence of aprotein contains a valine residue (val) at a particular place, what new amino acid(s) would most often appear in place ofthe valine residue as

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 2P

See similar textbooks

Similar questions

Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.
Sickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Normal hemoglobin is created from the codon GAA, which codes for glutamic acid while sickle-cell hemoglobin has the codon GUA, which codes for valine. This is an example of what type of mutation? * O Insertion O Silent mutation O Deletion O Substitution mutation
GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
2. The following polynucleotide was synthesized and used as a template for peptide synthesis in a cell-free system from E. coli. -· AUAUAUAUAUAUAU- .. What polypeptide would you expect to be produced? What information would this give you about the code? 3. If the same polynudeotide described in Problem 2 is used with a mitochondria-derived cell-free protein-synthesizing system, the product is ... Met-Tyr-Met-Tyr-Met-Tyr- .. What does this say about differences between the mitochondrial and bacte- rial codes?
48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
. A mutational lesion results in a sequence containing amismatched base pair:5′ AGCTGCCTT 3′3′ ACGATGGAA 5′CodonIf mismatch repair occurs in either direction, whichamino acids could be found at this site?
Answer codon usage based on this description: You have isolated a new eukaryotic microorganism and want to determine the genetic code of its mitochondria. Here are the amino acids encoded after translation of two synthetic mRNAs using mitochondrial extracts from your eukaryote- in this experiment translation can start at any sequence position: RNA: Protein: Tyr-Met-Tyr-Met-Tyr-Met---- UAUAUAUAUAUAUAU--- UAAUAAUAAUAAUAA--- Asn-Asn-Asn-Asn-Asn---- Met-Met-Met-Met-Met---- Based on the results shown here, what can you conclude about the codons in this eukaryote? A. B. C. D. O A O C OD OB AUA Tyr Met Tyr Met UAU Met Tyr Met Tyr AAU Met Trp Asn UAA Asn Asn Asn Asn, STOP or Met Asn, STOP or Met
Please do answer all the questions. I'll definitely give a like You discovered a halophilic bacterium and want to characterize the mechanism involved in producing mature tRNA molecules from larger tRNA precursors. You isolated a large complex composed of a protein component and an RNA component that is capable of cleaving the larger tRNA precursor. To determine which one of the two components is responsible for catalysis, you perform an in vitro tRNA cleavage assay in the proper buffer conditions, including a low concentration of Mg2+ and 0.5 M bovine serum albumin (BSA). BSA is not specific for this reaction. The table below summarizes the results after performing eight separate reactions. The + symbol indicates the included reaction components. Q. Based on the results obtained, what can you conclude about the composition of the biological catalyst required for the maturation of tRNA? Q. Indicate which reactions helped you make your conclusion. Why? Q. Which reactions allowed you…
What is the primary difference betwee class I and class II aminoacyl-tRNA synthetases. a. Class I synthetases acylate the terminal 2’ hydroxyl group of tRNAs; Class II synthetases acylate the terminal 3’ hydroxyl group of tRNAs. b. Class I synthetases acylate the terminal 3’ hydroxyl group of tRNAs; Class II synthetases acylate the terminal 2’ hydroxyl group of tRNAs. c. Class I synthetases acylate tRNAs with hydrophobic amino acids; Class II synthetases acylate tRNAs with polar amino acids. d. Class I synthetases acylate tRNAs with polar amino acids; Class II synthetases acylate tRNAs with hydrophobic amino acids.
SARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/A
1. The following synthetic polynucleotide is synthesized and used as a template for peptide synthesis in a cell-free system from E. coli. ..AUAUAUAUAUAUAU-… What polypeptide would you expect to be produced? Precisely what information would this give you about the code? 2. If the same polynucleotide described in Problem 1 is used with a mitochondria-derived cell-free protein-synthesizing system, the product is .Met-Tyr-Met-Tyr-Met-Tyr-.. What does this say about differences between the mitochondrial and bacterial codes?
Correct! The Leu codon is changed to a nonsense codon by a single-base substitution How many different ways can the LEU codon be changed into the nonsense mutation? 362110