Q.(a) Supermolecules are contructed by involvement of weak interactions. Explain weak irteractive forces in detail. (b) Comment of the following interactions; Watson and Crick base pairing versus Floogsten base pairing. possibility of purine-purine, purine- pyrimidine, pyrimidine-pyrimidine interaction in DNA helix. (c) Compare structural features of bicyclic and trieyclic cryptands and their receptor properties.
Q: 4. Cholera is a disease caused by bacteria that make cholera toxin. In the presence of this toxin,…
A: Mode of action of cholera toxin that leads to diarrhea:-
Q: The following micornutrients are especially important to an athlete EXCEPT? A. Vitamin B B.…
A: Micronutrients are necessary for power generation, haemoglobin synthesis, bone density, appropriate…
Q: What are the divisions of white light according to the electromagnetic spectrum? Which are the two…
A: The white light is made up of seven colors spread between the wavelength of 400 nm to 780 nm. This…
Q: Discuss the stages or process of DNA and Cell replication. 2. What is DNA repair and discuss
A: DNA is a double stranded molecule which are linked together by hydrogen bonds. DNA replication means…
Q: What is phylogeny and morphology ? What are some of the pathogenic traits and animals that they can…
A: Answer :: What is phylogeny : Brief description :- Taxonomy is defined as the science dealing…
Q: The medical practice you're working for testing an average of 22.4 patients a day for the past 3…
A: Medical practice: A sole proprietorship, a partnership, an association, a professional corporation,…
Q: Why is COVID 19 and getting the vaccinated important, citing from a source?
A: NB: for your kind knowledge, according to Bartleby rules and regulations we can't mention…
Q: A person’s blood type is the result of expression of a gene with three alleles. However, only 2…
A: The blood group is determined by the presence of specific antigen on the plasma membrane of red…
Q: describe the function of NAD+ and FAD. Also, describe the difference between NAD+ and FAD.
A: The ATP is indirectly formed through a series of reactions of oxidative phosphorylation . It yeilds…
Q: What is Medical Terminology, why is it beneficial to know , what is it used for …. How can it be…
A: Introduction :- Medical terminology is a vocabulary that is used to precisely describe the human…
Q: Olfaction Taste Hearing Vision Bony Fishes Frog (Amphibians) Crocodile (Reptiles) Chicken (Aves)…
A: The mammals belongs to the class Mammalia. They are any member of the group of vertebrate animals in…
Q: How does the genus name of Diphyllobothrium latum reflect the appearance of the scolex?
A: Introduction Diphyllobothrium is a tapeworm genus that can cause diphyllobothriasis in humans if raw…
Q: Where do optometry work? eg private/small business operators; large health service systems eg…
A: Introduction Optometry:- It is a healthcare profession which involves examining the eyes and related…
Q: The following are critical factors for bacteria to survive EXCEPT? A. Appropriate temperature B.…
A: Bacteria can survive in temperatures that are hotter and colder than mammals, but they thrive in a…
Q: Turpentine oil is obtained from- (A) Coal (B) Petroleum (C) Cedarwood (D) Pinus
A: Introduction - Turpentine is a liquid produced by distilling resin from living trees, primarily…
Q: Briefly describe and explain how two cardiovascular diseases can be caused by atrial fibrillation.
A: Irregular puls of heart is one of the serious causes of cardiovascular disease. Many cardiovescular…
Q: Case fatality rate. Based table 1, what conclusion can you draw about the risk of acquiring…
A: Tuberculosis (TB) is caused by bacteria Mycobacterium tuberculosis that most affect the lungs.
Q: Give an example of a strain of bacteria (Genus and species) that is now resistant to commonly used…
A: Antibiotic/anti-microbial resistance defines all evolved mechanisms, that confer the protection to…
Q: double-stranded length of DNA is exposed to a restriction enzyme. The enzyme finds 3 recognition…
A: Restriction enzymes Restriction enzymes are the specific enzymes that cleave the DNA in very…
Q: 7) This refers to the pattern being followed by the arrangement of an animal's body parts. 8) This…
A: The organisms are classified into three categories based on symmetry - Assymetric Radially…
Q: ABSOLUTE HUMIDITY 1. the amount of water vapor in grams per cubic meter of air at a given…
A: Absolute humidity (measured in grammes of water vapour per cubic metre of air) is the amount of…
Q: What is the article "Stopping pandemics before they start: Lessons learned from SARS-CoV-2" about?
A: Introduction SARS-CoV-2 is a member of a large family of viruses called coronaviruses, This virus…
Q: 3. Which of the following hormones increases pancreatic juice (including pancreatic enzymes and…
A: Pancreatic juice is a liquid secreted by the pancreas that contains digestive enzymes such as…
Q: To explain: The reason of plant wilting using cohesion theory of water transport.
A: Plant withering is the phrase for when a plant loses its firmness. Because of a decrease in the…
Q: receptors have their neurotransmitter binding site and ion channel are components of different…
A: Answer 1: the receptors have their neurotransmitters binding site and ion channels are components of…
Q: Explain the importance of describing the morphological characteristics of bacterial colonies when…
A: Introduction A bacterial colony is a cluster of bacteria that all came from the same mother cell.…
Q: You work for a large biotechnology company that is studying viruses, vaccines, and small molecule…
A: There are few important points that should be kept in mind : Viruses are simple ,noncellular and…
Q: In order to insert foreign DNA into a plasmid for molecular cloning, the main components required…
A: Plasmids are small, double stranded, closed circular, symbiotic DNA molecules that occur naturally…
Q: Glycolysis and gluconeogenesis are irreversible processes and that both occur largely in the cytosol…
A: Reciprocal Regulation of Gluconeogenesis and Glycolysis The processes of gluconeogenesis and…
Q: A 14 year old vegetarian experience swelling of feet and face as well as diarrhea and general…
A: Fasciola hepatica, often known as the ordinary liver fluke or sheep liver fluke, is a parasitic…
Q: Stretching a skeletal muscle can depolarize sensory afferents that project into the spinal cord and…
A: Muscles Muscles are the soft tissue with ability to contract hence help in movement of body parts.
Q: n example of phase 2 reaction is: A Glucosidation Aromatic hydroxylation C) All of the above D)…
A: 5. The addition of hydrophilic compounds to the parent molecule, a poisonous intermediate, or a…
Q: How are squalus (shark) brain and sheep brain similar and different? Please avoid copying the…
A: Squalus It represents the genus of dogfish sharks which belong to the family of Squalidae. These…
Q: A worker in a nuclear power station receives the following radiations while working in 1 year: 85mGy…
A: Introduction :- Radiation is energy that originates from a source and travels at the speed of light…
Q: Who is responsible for determining the safety andf efficacy of any dietary supplement? A. FDA B.…
A: Introduction Dietary supplements are substances that you can take to enhance your diet or reduce…
Q: Types of Reproduction (Sexual or Asexual) Organisms Method of Reproduction 1. Hydra 2. Banana 3.…
A: Budding is hydras' most frequent asexual reproductive technique. Buds emerge from the point where…
Q: 1) Figure 20 shows that the European otter (Lutra lutra) and the American badger (Taxidea taxus)…
A: Introduction phylogeny is the study of a species' or group's evolutionary history, particularly in…
Q: state the source of the energy in the food eaten by the ox
A: The ox are used in field for ploughing the fields. The ox are also known as male bullock, they lack…
Q: What is the mechanism for lymphocyte maturation so that lymphocytes will respond to non-self cells…
A: Introduction:- White blood cells, or lymphocytes, are one of the body's main types of immune cells.…
Q: Concerns with the resident microflora of the Gl tract and certain toxicants include A Microflora are…
A: 18. The most essential enzymes engaged in the phase I metabolism of medicines and toxins in…
Q: Medium/test Used Negative result Indicators, key regents, or key ingredients Positive result…
A: Dear student as per Bartleby policy i can solve first three parts only. Please post the remaining…
Q: Which of the following is a 'club moss' ? (A) Selaginella (B) Equisetum (C) Lycopodium (D) None of…
A: Introduction - Club mosses have needlelike or scalelike leaves and are low evergreen herbs. Many…
Q: To explain: The reason of plant wilting using cohesion theory of water transport.
A: Plant withering is the phrase for when a plant loses its firmness. Because of a decrease in the…
Q: The FITT principle is? A. The principle that a good physical fitness program should be based on…
A: Exercise is a significant aspect of determining an individual's health. Lack of physical activity…
Q: What role does the human microfauna play in protecting humans against pathogens? (At this point in…
A: The human host and its microbial flora form a complex ecosystem whose balance is a striking example…
Q: uestion 6 hich conditions would NOT lead to good preservation of a dead hominin skeleton? Dying in a…
A: Erect posture, bipedal mobility, larger brains, and behavioural features like as specialised…
Q: Look for recent (2017 to 2022) scientific papers, stories, or features that demonstrate the use of…
A: Introduction Spectroscopy is a broad field of study that examines and interprets the electromagnetic…
Q: ture MRNA. What are these modifications and what are their significance? Use = following terms to…
A: When introns are eliminated and the mRNA is regarded suitable for translation, eukaryotic pre-mRNA…
Q: G E /99 Livingstone BIODIDAC Livingstone BIODIDAC Figure 2. Frog's Internal Anatomy (Part 1) Figure…
A: To identify: To identify the body parts of the frog from the given frog's internal anatomy diagram.…
Q: How does capillary electrophoresis differ from gel electrophoresis? a) The capillary system can…
A: Gel electrophoresis is done in a vertical or horizontal plane with a polymeric matrix of…
please provide answers of each question earlier
Step by step
Solved in 4 steps
- pppApCpCpUpApGpApU-OH(a) Using the straight-chain sugar convention, write the structure of the DNA strand that encoded this short stretch of RNA.(b) Using the simplest convention for representing the DNA base sequence, write the structure of the nontemplate DNA strand.(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21Describe the functions of the following proteins during DNA breaks and repair: (i) Ku70 (ii) Uracil DNA glycosylase
- Briefly explain (1) the structure characteristics of DNA, (2) why different DNA molecules (i.e., with different sequences) could adopt the same B-form double helical structure, and (3) how certain proteins could recognize the specific sequences with the common B-form DNA.Part II: Information Transfer Background Information - Key Points The background information provided for this lab has given you a general overview of some of 24 the key terms and definitions necessary to understand the transfer of information from gene to protein. The information included below will help you work through the specific problems included in your Tutorial 4 Assignment. When working on the problems remember the base mu to pairing rules (Table 3). Table 3: Rules for nucleotide base pairing. cytosine (C) - guanine (G) adenine (A)- thymine (T) DNA RNA For Transcription: ● ● ● ● cytosine (C) - guanine (G) adenine (A)- uracil (U) Initiation is determined by the recognition of the promoter sequence in the DNA by the RNA polymerase. Stef The transcription start site is downstream of the promoter and is designated as the +1 site. Aspartic acid Alanina Valine Arginine Serine Lysine Asparagine Glutamic TEOPO|0C|AGUCAG|UC|AG/DCAG/3G/ CAGUC UGU A C A Threonine G Methionine Isoleucine…2.1 Given the following eukaryotic DNA strand, transcribe and translate the DNA into apolypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams,colours and annotations to describe how the DNA strand will be synthesized into afunctional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in theDNA, hypothetically S pairs with B and M pairs with D).
- 2.1 Given the following eukaryotic DNA strand, transcribe and translate the DNA into apolypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams,colours and annotations to describe how the DNA strand will be synthesized into afunctional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in theDNA, hypothetically S pairs with B and M pairs with D). 2.2. Describe what are missense mutations and its effects on structure and function usinghaemoglobin as an example .The specificity of Watson-Crick nucleobase pairing enables the biological information to be encoded and passed down through generations of cells and organisms. This specificity arises from the chemical structure of the base pairs, namely the pattern of hydrogen bond donors and acceptors that stabilize only two pairing interactions] relative to the others. How many possible pairwise interactions could potentially exist at a single position within a sequence, including the correct pairs, and all possible other combinations of DNA bases?Recall the DNA’s three-dimensional model. The DNA is a right-handed helix wherein onecomplete 360 0 turn covers a distance of 34 angstroms (Å) or 3.4 nm and 10 base pairs. As a result, thebase pairs are separated by a distance of approximately 3.4 Å. The diameter of the Watson and CrickDNA molecule is 20 Å.Calculate the average number of nucleotide pairs (or base pairs) per micrometer of DNA doublehelix according to the dimension mentioned above. Round off your answer to the nearest wholenumber. Note also that 1 micrometer = 10,000 angstroms.
- 131.) How many different sequence possibilities are there for a double-stranded RNA polymer that is 6 bases long? A) 64=(25) B) 192= (3x 25) C) 1296= (6) D) 4096= (45) E) 8192= (2x45)2A Draw the complete structure of the trinucleotide 5'-A-G-C-3' (DNA).Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).