GQ2 Question 2ListenTina Is the mother of Violet, Jose, Kelly and Paul. Ramone is a potential father. You are trying todetermine which if any children could be the offspring of RamoneTina Ramone VioletJose KellyPaulGene 1Gene 2You analyze 2 genes Gene 1 and Gene 2 known to have variable numbers of repeats.After PCR and gel electrophoresis, you get the results shown above.Based on these results you conclude that Josea) Must be the offspring of Ramone and and Tinab) Can not be the offspring of Ramone and Tinac) Could be the offspring of Ramone and Tina

Answered: Image /qna-images/answer/0d211e92-0bdc-4599-aaa6-10f3c3f32e1e.jpg

Answered: Question 2 Listen Tina Is the mother of…

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

QUESTION 7 Primers are needed to start a PCR reaction True O False QUESTION 8 Restriction enzymes specifically recognize and cut short sequences of DNA called introns. O exons. O sticky ends. restriction sites. QUESTION 9 The DNA profiles used as evidence in a murder trial look something like supermarket bar codes. The pattern of bars in a DNA profile shows O the order of genes along particular chromosomes O the order of bases in a particular gene O the presence of differently-sized fragments of DNA O the presence of dominant or recessive alleles for particular traits O the number of chromosomes and whether any are damaged
Question 2. You have a wild-type strain of E. coli with the genotype A B C D EF You introduce an F+ plasmid into your wild-type strain and isolated a few Hfr derivative strains that you call Hfr1, Hfr2, and Hfr3. You are studying several new genes in E. coli with interesting phenotypes. You obtain a multiply mutant strain with chromosomal genotype: a b c d e f a) You mate each Hfr strain to your multiply-mutant strain in a separate experiment. At various times you interrupt the matings and plate the bacteria under conditions in which only the recipient strain can grow. You obtain the following earliest-time-of-entry data, in minutes: Gene Hfr1 Hfr2 Hfr3 A B C D E F 11 13 7 I 26 16 11 9 5 31 15 27 31 11 Draw a map of these genes that is consistent with the data, including all the genes and Hfr origins, the distances between them (in minutes), and the direction of transfer of each Hfr.
b) Among the progeny from the Hfr3 mating above, you find one that has the genotype: Abc de F Draw out the gene transfer and crossover(s) that produced this outcome: c) Among the progeny from the Hfr3 mating above, you find one that has the genotype: A B c d e f Draw out the gene transfer and crossover(s) that produced this outcome:
| Choose J [Choose] repetitive DNA transposable elements transposon retrotransposon pseudogenes
Question 5 Review DNA sequencing and cloning tools. Which of these is not used to make a recombinant DNA? O restriction enzymes to create sticky ends of a plasmid O fragment from a different DNA cut by the same restriction enzyme O DNA ligase seals the recombinant DNA O denaturation
Question 1. Although we will not be doing a gel electrophoresis, data from a gel digest of a Bacillus anthrax plasmid is provided so you can do a DNA map. The Bacillus anthrax plasmid is 4000bp (4Kb) long. Note the origin position as well as the reference molecular weight markers on the gel. Two restriction enzymes, A and B, were used to obtain two individual digests, A and B. They were combined to produce the third digest. The restriction enzyme fragment pattern for the digest of Bacillus anthrax plasmid Determining the Number of Fragments How many fragments were produced by enzyme A? How many fragments were produced by enzyme B? How many fragments were produced by the combined digest (A and B)? Fragment Size Fragment size is relative to molecular weight, and must be determined by comparing the fragment distance to the molecular weight markers. The fragment size has been provided on the gel pattern for this exercise. To make a map you must determine the relative positions of the…
QUESTION 49 You have discovered a very small amount of DNA from an ancient organism that you want to save and study. What is the very first thing you should do to allow you to study this DNA in the lab? O a. Insert the DNA into a vector Ob.RT-PCR Oc. Gel electrophoresis. O d.PCR Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All Answers Save and Submit Scie
QUESTION 6 Place the Polymerase Chain Reaction events listed below in the order in which they occur. Double-stranded DNA is produced DNA sample is heated Test tube with DNA sample is placed in machine Taq polymerase initiates DNA synthesis DNA denatures
Using the designed forward and reverse primer from Question 23-30, you performed PCR to amplify the CO1 gene of S. tawilis. Then, you verified the PCR product using the Agarose Gel Electrophoresis. Here is the result of the AGE. M-Marker L1-PCR Product ML1 You noticed that there are many bands in your PCR product. What does this indicate? Choose the best answer. The primers were not specific to CO1 gene. The annealing temperature is too high. The templated DNA is not enough. There is a formation of primer dimers. The primer length is too short. The melting temperature is too high.
QUESTION 2 Variable expression of the MERRF syndrome arises from recombination between nuclear and mtDNA O homoplasmic cells mitotic segregation nuclear genes environmental factors
QUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…
QUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…

SEE MORE QUESTIONS

Recommended textbooks for you

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning