Question 2. From mouse nerve cells you isolate the mouse Tau-gene-containing DNA fragment and hybridize it to the mRNA encoding Tau from the cytoplasm of the same cells. Describe what you see when you look at the molecules under the electron microscope. A. A double-stranded DNA-RNA hybrid with complete overlap of all the sequences. B. A partially double stranded DNA-RNA hybrid molecule containing regions of DNA-RNA overlap representing the mRNA exons, loops where there are introns and tails at the 5' and 3' ends. C. A partially double-stranded molecule containing regions of DNA-RNA overlap representing the mRNA introns, loops where there are introns and tails at the 5' and 3' ends. D. Regions of DNA-RNA overlap representing the mRNA exons and loops where there are introns with no tails at the 5' or 3' ends. E. Two distinct molecules with no overlapping regions.

Question 2. From mouse nerve cells you isolate the mouse Tau-gene-containing DNA fragment and hybridize it to the mRNA encoding Tau from the cytoplasm of the same cells. Describe what you see when you look at the molecules under the electron microscope. A. A double-stranded DNA-RNA hybrid with complete overlap of all the sequences. B. A partially double stranded DNA-RNA hybrid molecule containing regions of DNA-RNA overlap representing the mRNA exons, loops where there are introns and tails at the 5' and 3' ends. C. A partially double-stranded molecule containing regions of DNA-RNA overlap representing the mRNA introns, loops where there are introns and tails at the 5' and 3' ends. D. Regions of DNA-RNA overlap representing the mRNA exons and loops where there are introns with no tails at the 5' or 3' ends. E. Two distinct molecules with no overlapping regions.

Name: Question 2. From mouse nerve cells you isolate themouse Tau-gene-cont
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Question 2. From mouse nerve cells you isolate themouse Tau-gene-containing DNA fragment andhybridize it to the mRNA encoding Tau from thecytoplasm of the same cells. Describe what you seewhen you look at the molecules under the electronmicroscope.A

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Question 4. Given the probability that a restriction enzyme will cut DNA if the recognition sequence for the enzyme is 5'-GGATCC-3' and the GC content is 60%, c) Which of the following will lead to DNA cutting more frequently? Choose all that apply. O Increasing the AT content to 60% O Using a seven base cutter with the sequence 5'-GGATCCC-3' O Using a five base cutter with the sequence 5'-GGACC-3' O Increasing the GC content to 70% O Decreasing the GC content to 50%
Question 1. Suppose that the diagram below represents the genomic organization of an enzyme involved in eye pigment production in mice. Within the gene are four exons. Biochemical analysis has revealed that the active site of the enzyme is located in the C terminus of the protein. The nucleotide length of each exon and intron is shown. The dinucleotide sequence GT represents the 5’ splice site and the dinucleotide sequence AG represents the 3’ splice site. Both the 5’ and the 3’ splice sites must be present for splicing to occur. Assume that the first and second stop codons are located immediately after the first and second 5’ splice sites, respectively; the third and fourth stop codons are located near the 3’ end of exons 3 and 4, respectively; all these stop codons are in the correct reading frame. E) Suppose you isolate a mutant mouse that has white eyes. When you examine the size of the eye pigment enzyme produced by this mouse, you see that it is 400 amino acids long. Sequence…
Question 4. What is the probability that a restriction enzyme will cut DNA if the recognition sequence for the enzyme is 5'-GGATCC-3'? a) Assuming that the four bases are equally likely to be found in a DNA molecule. O (1/4)6 O (1/4)4 O (1/6)4 O 1 in 6 O (1/6)6
Question 8. You isolate the DNA from the bacterial cells and apply the Sanger dideoxy sequencing method. You then separate the products of the reactions by gel electrophoresis and obtain the following pattern. What is the sequence of the template and the DNA on the gel? ddATP ddTTP ddCTP ddGTP Template V [ Choose 3'-CTAGTCAAGG-5' 5'-CTAGTCAAGG-3' Sequence 3'-GATCAGTTCC-5' 5'-GATCAGTTCC-3' 5'-GGAACTGATC-3'
Question 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 3' 5' GATTCCGTATTACAGCATAGGCTATATT CACGTGGATGGTCAGTA... 3' CTAAGGCATA ATGTCGTATCCGATATAAGTGCACCTA CCGATCAT... 5' Start site
Question 4. What is the probability that a restriction enzyme will cut DNA if the recognition sequence for the enzyme is 5'-GGATCC-3' ? b) Assuming that the % GC is = 60%. O (2/10)4 (3/10)² O (3/10)4 (2/10)² O (1/6)4 O (1/4)6 O (6/10)4 (4/10)2
QUESTION 7 UUUUU..3' Rho-independent (intrinsic) terminators in bacterial transcripts consist of a sequence that forms a "hairpin" stem-loop structure, followed in the direction of transcription by a polyuridine (polyU) sequence, as shown in the figure above. Which of the following template strand DNA sequences, when transcribed, will form a terminator structure in the transcript? 5 CCGACGTATCCGACGTTTTTTTT3' 5'AAAAAAAACCGACGTATCGTCGG3' 5 CCGACGTATCGTCGGAAAAAAAA3' 5 TTTTTTTTCCGACGTATCGTCGG3' 5 AAAAAAAACCGACGTATGCAGCC3'
QUESTION 21 Choose each of the characteristic(s) of all RNA polymerases from the list below. A. elongation adds new ribonucleotides to the 3-OH B. requires a primer to initiate synthesis C. have 3' to 5' exonuclease activity D. adds nucleotides based on sequence complementarity to a template E. have 5' to 3' polymerase activity O F. elongation adds new ribonucleotides to the 2'-OH G. have 3' to 5' polymerase activity
Question text A DNA sense strand contains the following nucleotide base sequence: TAC AGC AAT CÁC From this, what is the nucleotide sequence of the MRNA strand that is transcribed? Select one: a. ATG TCG TTA GTG b. UAC TGC AAU CUC C. AUG UCG UUA GUG d. UAC AGC AAU CÁC
Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?
Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.