QUESTION 24 1. W. D. Hamilton's theory that individuals at the center of a group have the lowest domain of danger is referred to as Safe haven Selfish herd Herd mentality Herd immunity None of the choices

Q: As shown in Figure 13-22, how many different transcription factors govern where the Distal-less…

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…

A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…

Q: number 32

A: Linked genes  The genes are said to be linked if they are tend to pass together in sperm of egg.

Q: 21. Which macromolecules always contain carbon, hydrogen, oxygen, nitrogen, and sulfur? A. nucleic…

A: Introduction:- Any exceedingly big molecule with a diameter ranging from roughly(105 to 103 mm) is…

Q: The annual flu shot is composed of either live attenuated influenza virus or influenza subunits (the…

A: The shots of flu can be given in several forms, such as: Needle-free vaccine. Nasal spray. High…

Q: Define 'oestrus' and 'menstrual cycles.

A: There are a few key ways that pregnancy and the menstrual cycle are related. First, both involve the…

Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…

A: Let suppose the coat colour is controlled by the gene A, As there are many traits for the coat…

Q: A woman who has A blood type (her mother had blood type A and her father had blood type B) has a…

A: According to our guidelines, we are required to answer only the first three questions in case of…

Q: What biochemical mechanism underlies affinity maturation of the antibody response?

A: Antibodies mediate the adaptive immune response and are produced by plasma cells.

Q: n 2010, 150 coyotes (Canis latrans) were counted in Pierce County, WA. The population was surveyed…

A: Carrying capacity is defined as :-

Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 lb. 3/195 of the F2…

A: The answers attached below.

Q: A young lady requested pre-marital genetic counselling because her sister had died in infancy of…

A: Gangliosidosis refers to a group of lipid storage illnesses caused by the buildup of lipids called…

Q: How do you properly write the scientific name using binomial nomenclature of the new species?

A: Binomial nomenclature  The binomial nomenclature is a scientific method for naming newly found…

Q: The genes that codes for the creation of certain blood groups are located on chromo- some "Xp22.3",…

A: Blood Inheritance Our blood type, like our eye or hair colour, is inherited from our parents. Each…

Q: 9. a. What fossil primate possesses traits of both anthropoids and hominoids? b. What are those…

A: Hominid is a sort of primate that has a place with the family Hominidae. In scientific…

Q: A......of a DNA consists of a sugar, a phosphate, and a nitrogen containing base. A....... is a…

A: DNA stands for Deoxyribonucleic acid. It is the genetic material in humans.

Q: alanine that would exist at the pH indicated below.

A:

Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 Ib. 3/195 of the F2…

A: Solution Lowest weight = 5 lb Highest weight = 29 lb Weight difference = 24 lb 3/768 = 1/256 Four…

Q: what is the purpose of calcium ion in fertilization?

A: * Fertilisation is an generative fertilisation fusion of gametes gives rise to a new individual…

Q: Enumerate and briefly explain four major factors that influence the ability of the female to produce…

A: Egg production can be affected by such factors as feed consumption (quality and quantity),water…

Q: Sample problems related to non Mendelian inheritance Read, analyze and answer completely the…

A: 1. If parents have blood group of men - Ao , AA, female-  BB , Bo  Then children will be AB, AO, BO

Q: Discuss the principles and applications of Laser-Doppler Anemometer to Agricultural and Biosystems…

A: Laser-Doppler anemometers (LDAs) are non-intrusive optical instruments that can be used to measure…

Q: The feature of cells in epithelial sheets that prevents mixing of the apical and basolateral…

A: Epithelial is the type of tissue that forms a covering on all internal and external surfaces of…

Q: Describe the similarities in sexual reproduction of moss and fern.

A: The similarities in sexual reproduction of moss and fern are:

Q: Based on Figure 14-14 and the features of ultraconservedelements, what would you predict you’d…

A: Introduction Gene expression is the process through which information from a gene is used to create…

Q: After you complete an assessment of a patient in a clinical area or in a simulation laboratory,…

A: There are few important points about an assessment of patient in a clinical area and main points…

Q: B5. When a tapeworm obtains nutrition from the human intestine, but causes harm to the human host in…

A: Different types of species interactions are found that are classified according to their nature. In…

Q: number 32

A: Introduction:- A basic unit of heredity and a sequence of nucleotides in DNA that encodes the…

Q: Mention the important characteristics of coelenterate and give examples

A: Coelenterate Classification: Kingdom: Animalia Subkingdom: Eumetazoa Phylum: Coelenterate They…

Q: If all copies of a given locus have the same allele throughout the population, the allele frequency…

A: The relative frequency of an allele at a given locus in a population, represented as a fraction or…

Q: 4. Why do you think is the classification of organisms important? 5. Do you personally agree with…

A: Introduction Biological classification refers to the process of arrangements of living organisms…

Q: Virology: How does the influenza virus corrects packaging of all genome segments

A: Genome packaging is a basic interaction in a viral life cycle. Numerous viruses gather preformed…

Q: In sexual differentiation, parts of the male reproductive system develop from the:

A: The formation of different proteins that lead to formation of different cells and thereby tissues…

Q: 3. You are surveying an area's rock layers using absolute dating. You have an element whose…

A: Absolute dating is a method used by geologists and archaeologists to determine the age of a…

Q: Adaptive Immunity Briefly describe the adaptive immune response to Canine Parvovirus .

A: Adaptive immunity is likewise referred to as acquired immunity or particular immunity and is only…

Q: Which of the following is a characteristic or criterion used to evaluate an antibiotic? The answer…

A: Antibiotics are a class of chemical compounds that destroys or retards the growth of Microorganisms.…

Q: In food canning, please help me differentiate the following: flat, flipper, springer, soft swell and…

A: Introduction Canning is a method of preservation of food in which the food contents are processed…

Q: These are the specific name of an independent taxonomic group of any rank.  A. Character B.…

A:

Q: How many types of “foreign molecules” (use the proper term where needed) does each cell recognize?…

A: Antigens can be classified according to their source: Antigens from outside the body Exogenous…

Q: Describe the generation of multiple-drug-resistantplasmids

A: Drug inactivation or modification is one mechanism of drug resistance. Changes to the target site.…

Q: Why are regulatory mutations at the mouse Sonic hedgehog gene dominant and viable? Why do coding…

A: Introduction A gene mutation is defined as a change in the nucleotide sequence in DNA. This…

Q: In rabbits, mono-colored fur (F) and straight ears (E) are dominant over spotted-fur and floppy…

A: Given: In rabbits, mono-colored fur (F) and straight ears (E) are dominant over spotted-fur and…

Q: For some traits, one allele is not completely dominant to another.  Incomplete dominance occurs when…

A: Incomplete dominant traits are those traits in which one allele is not completely dominant to…

Q: 11. Choose from the following types of inheritance and write in the 1st column which one is…

A: Mendelian inheritance states that the genes assort independently but this doesnot apply to every…

Q: You isolate a glp-1 mutation of C. elegans and discoverthat the DNA region encoding the spatial…

A: The genome is made up of one to several long DNA molecules, and mutations in these molecules can…

Q: Why coes the root grow between the leaf axil and internode?

A: Roots are the part of a plant that typically grows underground. They anchor the plant in the ground…

Q: escribe the important characteristics of gymnos

A: Plants- These  are multicellular organisms that can be distinguished from other living things by a…

Q: Glycolysis produces_____and_______through oxidizing_____ and ____ choose from the following:…

A: Glycolysis Occurs in cytoplasm. Common phase for aerobic and anaerobic respiration. It involves a…

Q: explain: Insects are ectothermic, and the respiratory rate is usually proportional to the…

A: EXPLANATION  Ectotherm is the group of organisms that use an external heat source to perform their…

Q: How can the heart be strong enough to pump blood up your legs against gravity?

A: The heart is incapable of pumping blood back up the veins in your legs and back to your heart on its…

Intelligence

Intelligence refers to the intellectual functioning that compares a person's intelligence quotient (IQ) with other people of the same age. In other words, it is the ability to understand circumstances or situations and arrive at appropriate solutions. Both animals and plants exhibit intelligence.