Question Completion Status: QUESTION 2 In the fermentation part of this lab, we are measuring the production of what product? a. Carbon dioxide (CO2) O b. alcohol O c. lactic acid Od. All the above
Q: Principles and methods of sterilization
A: introduction: In healthcare facilities, sterilisation is a process that uses physical or chemical…
Q: I need The brief explanation and the predicted results for each organism in the list.
A: This lab will introduce the technique of streak plate isolation, which is a method used to isolate a…
Q: Differentiate between Gram Positive, Gram-negative, and Acid Fast cell wall. Explain the structure…
A: There are two categories of bacteria, and they are Gram-positive and Gram-negative bacteria. But not…
Q: Assume that you are adding 300 microliters of 1% substrate solution per well in a 24-well plate. If…
A: Fibronectin is a glycoprotein found in the extracellular matrix of cells and is also obtained from…
Q: esc Which of the following is an organ through which nutrients, gases, wastes are exchanged? 1…
A: Introduction :- The cloaca is a term used in anatomy to refer to a common cavity in which the…
Q: what will happen if diltuing the NAOH solution before filling the buret? will it raise or lower the…
A: NaOH is the chemical formula for sodium hydroxide, also known as caustic soda. It is a strong base…
Q: In a species of fish, the allele for long fins (F) is dominant over the allele for short fins (f).…
A: Given:- The allele for long fins (F) is dominant over the allele for short fins (f). we cross a…
Q: Material (wound disc sent to the bacteriolo bacteria. 1. What principle of is
A: Introduction: An anaerobic microscope is a specialized type of microscope designed specifically for…
Q: Fill in the blank space: Foods that are blank in nutrient blank are called blank - blank foods.
A: Food nutrients are the components of food that give the body energy and support growth, health, and…
Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…
A: Introduction : One of the earliest steps in gene expression is transcription. The transfer of…
Q: rotifers feed more on unicellular yeast
A:
Q: 3.Distinguish between heat and temperature
A: Heat is a form of energy that is transferred from one object to another due to the difference in…
Q: 3. What health teachings can you give to the donor of the fecal sample who was found to have these…
A: The donor of a fecal sample has been found to have parasites, which can cause a range of health…
Q: Explain lysogenic conversion and discuss it’s importance. *keep it short*
A: Viruses are obligate intracellular parasites that lives inside a host cell. It can undergo lytic…
Q: 1.Write the equation for the dissociation and re-formation of water
A: In the dissociation of water, a water molecule (H2O) splits into a hydrogen ion (H+) and a hydroxide…
Q: If airway diameter changes in the same direction as lung volume, describe a possible effect of hot…
A: Depending on the cause and the individual, interstitial lung disease might differ. It can progress…
Q: Explain the ripening process (including the physiological process) of (a) banana and (b) papaya
A: Ripening is the process through which fruits become ripe and edible. It is a complex and genetically…
Q: 5) Contrast bone modeling and bone remodeling: a) bone remodeling makes the bone grow wider, while…
A: Ossification is the process by which immature cells called osteoblasts lay down new bone material…
Q: Vasopressin is a hormone that is mainly released when the body lacks water. The release of…
A: Vasopressin is a hormone that plays an important role in regulating fluid balance in the body. It is…
Q: Which type of hybrid zone would lead to speciation? A. a hybrid zone b. stable hybrid zone c. A…
A: Introduction Speciation is the process by which a single species splits into two or more distinct…
Q: Briefly describe the means we use to classify acellular microorganisms. *keep it short*
A: Introduction :- Acellular microorganisms are microorganisms that do not have a cell membrane or…
Q: for a 5:1 insert: vector ligation reaction, including the volumes of insert and vector you…
A: Introduction: DNA is a long polymer made up of repeating units called nucleotides. It is the primary…
Q: When you drink boba, what type of energy are you harnessing?
A: INTRODUCTION Taiwanese-made boba, commonly known as bubble tea, is a beverage made with sweetened…
Q: Two populations of wildflower are found in the same meadow, and genetic analysis indicates that they…
A: Introduction :- Sympatric speciation is the process of speciation that occurs within a single…
Q: The integral membrane protein XYZR has a single alpha helix spanning the membrane. Where was this…
A: INTRODUCTION Integral membrane proteins are proteins that are embedded in biological membranes.…
Q: 2. Methods that used to determine the enzymatic activity of bacteria
A: Introduction Bacteria are single-celled microorganisms that can be found in almost every…
Q: What would happen if COP I vesicles were in the presence of a non-hydrolyzable GTP analog during…
A: In cells, proteins and lipids are transported by COP I vesicles, which are protein-covered…
Q: Match the organism to its description: Halobacterium spp. Bacillus spp. Anabaena spp. Euglena…
A: Living entities are categorized as unicellular or lultcullar based on their body Structure.…
Q: What is significant about the 3’ carbon in a growing DNA nucleotide sequence?
A: DNA or deoxyribo nucleic acid is the genetic material which contains a sugar backbone, phosphate and…
Q: 2.Explain the basis for the pH scale
A: pH is a measure of how acidic or basic a substance is. It is measured on a scale from 0 to 14, with…
Q: Which of the following is/are true with regard to the therapeutic index and the therapeutic window…
A: The therapeutic range is the range of doses for a drug in which it produces therapeutic effects with…
Q: Can you
A: Introduction: Bacteria are single-celled microorganisms that belong to the Kingdom of Monera. They…
Q: Ecology students are required to do a lab research project, and two students decide to study the…
A: Introduction : In an algebraic equation, an independent variable describes a variable whose values…
Q: In the lactase simulation you conducted in Part 1 of this Nutrition Lab, you found that enzyme…
A: Introduction Lactase stimulation refers to the increase in the activity of the lactase enzyme, which…
Q: Which of the f Dinding buffer 7
A: Introduction: A plasmid is a small, circular, double-stranded DNA molecule that is separate from the…
Q: individuals make productive use of the web? Can you explain the main distinctions between…
A: telemedicine and telesurgery belong to the field of telehealth, which encompasses the delivery of…
Q: NO NEED FOR EXPINATION JUST THE ANSWER THANKS. PLEASE ANSWER the questions correlty and please…
A: 1) Osteoporosis is a common medical condition characterized by decreased bone density and increased…
Q: 4) Looking at the epiphyseal plate, what zone is responsible for making new bone cells: a) zone of…
A: The epiphyseal plate is an area of growth in long bones found in children and adolescents. It…
Q: If the DNA that is about to be replicated has the following sequence: 5' ATTGCACTTAGGAATT 3' 3'…
A: INTRODUCTION The genetic material contained in all living things is called DNA.It is a…
Q: 8. You perform a PCR experiment using the template and primers shown below. What size is the…
A: PCR stands for Polymerase Chain Reaction. It is a laboratory technique used to amplify a single or a…
Q: Fresh water will be the most limiting factor for where human populations can live in the next 50…
A: Freshwater is present in the form of 3% of water on the earth. Some fresh water is locked in the…
Q: Can you explain how the upper-temperature limit to life is related to the stability of proteins or…
A: The upper-temperature limit to life is contributed by a complex interplay between many factors like…
Q: Using absorbance at 234 nm, 280 nm, and 260 nm, you calculated the percent of proteins present in…
A: Introduction :- A peptide is a short chain of amino acids linked together by peptide bonds. Peptides…
Q: When the mean of a population shifts from one generation to the next due to selection this is called…
A: Evolution: Evolution is the shift in a biological population's heritable traits over successive…
Q: Men are generally stronger than women because they typically have larger bodies, and a more…
A: Introduction Muscles are a type of tissue that enables movement in the body. They are responsible…
Q: Glycine, proline, and serine residues are rarely found in α helices. Explain why this is the case.…
A: Answer : Because of its asymmetric geometry and steric hindrance caused by its R-connection group's…
Q: A prenatal multivitamin supplement is more likely to restrict the amount of which vitamin? Niacin…
A: Vitamins and minerals are essential nutrients that the body needs to function properly. Vitamins are…
Q: Insulin will tend to increase (More than one answer may be correct): A) gluconeogenesis B)…
A: The INS gene in humans encodes insulin, which is essentially a peptide hormone generated by beta…
Q: C a b. d e f h
A: Introduction: The foundation of the nervous system are neurons. They communicate with various body…
Q: Which of the following are examples of experiments that demonstrated evidence of natural selection?…
A: Introduction: Natural selection is a process in evolution where organisms with advantageous traits…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- File Edit View History Bookmarks Profiles Tab Window Help Che X B. I. Rev X QUESTION 2 E. Beve X Match each of the following with the best responses: ✓uses an ETC with oxygen as the final electron acceptor, is an efficient breakdown process C. ra....docx Blac X AMAT X acconline.austincc.edu/webapps/assessment/take/launch.jsp?course_assessment_id=_1007563_1&course_id=_891351_1&content_i... MAT X Blac X N. SOL X does not require oxygen, contains ETC with non-oxygen electron acceptor does not require oxygen, does not contain ETC, incomplete breakdown reaction where electrons and/or hydrogen ions are lost reaction where electrons or hydrogen ions are picked up Writ X A. coenzyme of oxidation and reduction, picking up and dropping off electrons and G. oxidation hydrogen ions, which functions during cellular respiration Biol 1406 - LA....docx enzyme mediated direct addition of phosphate to ADP producing ATP enzyme fueled by hydrogen ion gradient allowing for the build up of ATP anaerobic…Test Tube # Enzyme 1 (uL added) Product Formation (umol) 1 0 0 2 25 0.08 3 50 0.15 4 75 0.22 5 100 0.3 6 125 0.37 7 150 0.45 8 175 0.53 9 200 0.59 10 225 0.68 11 250 0.74 A. Make a graph is Excel/Google Sheets plotting Product formation (umol) on the y-axis and Enzyme volume added on the x-axis. Paste the graph below. Make sure to have axis labels and a title on the graph. B. What can you conclude from this graph, ie how is the amount of product formed changing as a function of the amount of enzyme present?1:33 X 4G 14 77% cu.edu.pk/cpanelS/assign 30 ASSigmentS Class T ng Announcements Assessments Assignments Allow Asg Help File Date No Title Description File Upload Adde draw glycolysis pathway on 31- week 1 a page and Mar- Yes upload 2021 scanned copy of it. Evaluation No remarks added Remarks Copyright © 2021 CUSIT.
- Ulstein-freshair/Videos/D671260A4C0A005E4832B3E307A98B64/CS_Chapter_33.dom NBA... a Amazon.com: Onlin... ▸ Beyond The Lights... ▸ (6) The Reason Why... Case Study, Chapter 33, Introduction Open with Process Isaiah Blames Zora... 1. Label each scenario below with the letterthat corresponds to the step of the nursing process involved. (A) Assessment (P) Planning (1) Implementation (E) Evaluation After labeling, explain the rationale for your choices. (Learning Objectives 4, 5, 6) Scenarios: Mr. Johnson is admitted to room 337 in an acute care facility. The nurse interviews the client to determine the history of this illness, health history, and family history. The nurse then performs the head-to-toe physical assessment. Mr. Johnson has complained of acute leg pain. The nurse collects further data specifically regarding Mr. Johnson's leg pain. The nurse checks Mr. Johnson's admission orders and notes medication is ordered as needed for leg pain. The nurse returns to Mr. Johnson's room…I am needing help with questions 1 through 3, please. 1) What is the importance of the Control Group in the Yeast and Sugar Balloon Experiment? 2) Write out the general summary equation for alcohol fermentation below using the formula for glucose; label the substrates and the products in this equation. 3) Research: Initial background about yeast and fermentation- write a few sentences about yeast and fermentation based on what you know. In what situations do humans use yeast for fermentation?Sucrose initial Final delta %weight change Conc. weight weightweightincreaseX100/origi 1.41 6.41 28.2 0.1 6.38 1.38 27.6 0.2 5.80 0.80 16 0.3 5.05 0.05 1 0.4 4.50 0.5 |10 0.5 4.00 1 20 0.6 3.5 |1.5 30 0.7 2.90 2.1 42 0.8 2.20 2.8 0.9 |1.75 3.25 1.0 1.38 3.62 |72.4 Then 9. Determine the molar concentration of sucrose that gives 0% change in weight. Obtain the Ys using the previous formula. 10. Then compute the water potential using the fomula: Yw = Ys + 4p Your answer will be in units of J m3 (energy per unit volume) which are equivalent to pascal (Pa). Convert to MPa by dividing to 106. What is the sucrose concentration at which zero percent change in weight is observed: What is the water potential Yw of Tradescantia or Allium сера сells? What is the water potential Yw of the Solanum tuberosum potato cells? 6536 55 555555 5
- QUESTION 11 is not subject to oxidative deamination. а. G O b.c b. C С. Т O d. Av 11 v A A Aa v AaBbCcDdEe AaBbCcDc AaBbCcDdE AaBb( AaBbCcDdEe Styles Pane DE U v ab x, x A 2v A v 田。 No Spacing Heading 1 Normal Heading 2 Title Question 1: Compare and contrast the different metabolic pathways used by cells to generate ATP, illustrating your answer with a suitable table or diagram. Include in your answer discussion of the metabolic adaptations that occur in cells as they respond to changing internal and external environmental conditions.Review Over Glucose Metabolism Match each of the following occurrences to the correct part of the glucose metabolism process. If more than one answer is correct, write all letters in the blank. B. Fermentation A. Glycolysis C. Cellular Respiration (aerobic) D. Krebs Cycle Answer E. Electron Transport Chain 1. Most of the ATP is made Answer, 2. Occurs only under anaerobic conditions Answes. Occurs only under aerobic conditions Answer. Uses phosphorylation Answer5. Occurs under aerobic and anaerobic conditions Answer. Can occur under anaerobic conditions Answer 7. Glucose splits into 2, Pyruvic acid molecules Answer 8. Occurs in the mitochondria Answer 9. PGAL forms Answeio. Lactic acid forms Answer 11. Occurs in the cytoplasm Answer 12. Produces CO₂ and ATP Answe 3. Requires some ATP to get started Answe14. Ethanol produced Answer 15. Acetyl-CoA involved Answer 16. Citric acid cycle Answer 17. CO₂ not a byproduct Answig. H₂O is a byproduct Answer 19. Nets 2 ATP Answer 20. Completes…
- True or False 1. Cytochrome-mediated oxidation reactions are facilitated by microsomal enzymes. 2. Drugs bound to plasma proteins are ready for therapeutic action 3. Sublingual tablets, when administered , do not undergo absorption. 4. Generally, drugs with high lipid solubility are better absorbed into the bloodstream. 5. Urinary excretion of weakly basic drugs is enhanced by increasing the pH of the urine. 6. Most drugs are absorbed through active transport mechanisms. 7. Lying on the left side increases gastric emptying rate.Time left 0:4T:30 estion In the experiment of amylase extraction from barely seeds, after the second centrifugation- the amylase enzyme will be found in A yet vered ked out of Flag -stion B O a. B: Precipitate O b. A: Supernatant O c. B: Supernatant O d. A: Precipitate ENG E iSall zh DELLHi I hope you're doing fine. I need help with this questions please! Fermentation is necessary to recycle NADH under anoxic conditions.. How does NADH get recycled when oxygen is present? thank you!