refer to the code below str1="bar" str2="baz" for 11 in str1: for 12 in str2: x=11+12 x=x[1] After the program is executed, give the value of x
Q: Q2-Write program to find the value z from the following series x Z= 3x5 + + 4! 6! } 2! 10! Fortran
A: Code: program sum REAL Z,fact,x INTEGER i,j,k,m Z = 0 i=1 j=2 PRINT *, 'Enter x…
Q: (HTML & Javascript) Create a nested loop program that generates a multiplication table, but instead…
A: I have provided HTML CODE( having internal JS) along with CODE SCREENSHOT and OUTPUT…
Q: A has different usage/represents different things. What does mean/represent for each expression…
A: The Greek letter "L," that is used as a symbol for "wavelength." A lambda is a specific frequency of…
Q: Consideration must be given to the question, "What does this statement mean?" I'm asking this in the…
A: Given: So, in its most basic form, what is Critical Concern? Consideration comes in many different…
Q: How exactly do the principles of software engineering fall short of their potential? explain
A: Software for engineers: As a discipline, software engineering emphasizes a methodical approach to…
Q: Increasing cloud security after a compromise is possible? Are there any countermeasures you can…
A: Initiation Data breaches allow unauthorized access to classified, sensitive, or protected…
Q: 4. Design a four-input logic circuit is required to implement the Boolean function F(w, x, y, z)=…
A: Find Your Answer Below
Q: Question 4: Plot the function y = 3x³-26x+10, and its first and second derivatives, for -2≤x≤4. all…
A: Since no programming language is mentioned, I am using Matlab. Code: syms x y=@(x)…
Q: Single-row functions explain. Single-row vs. group functions: differences
A: SQL functions: The solution may be found in the next step. SQL functions that are considered to be…
Q: ram that counts how many vowels (a,e,i,o,u) character a user have entered, if the user enters a non…
A: We need to read in a character , then display whether it is a vowel or not.
Q: Explain the 5 types of sensors used in the WUMPUS WORLD.
A: Introduction: The agent from the Wumpus World is a knowledge-based agent that represents knowledge…
Q: case 3: // deposit operation cout > a; for (i = 0; i > a; for (i = 0; i <= 1; i++) { found =…
A: The given code screenshot has three 3 cases : case 3 : Deposit operation (To deposit amount) case 4…
Q: What is the problem with the software engineering principles? explain?
A: The solution to the given question is: INTRODUCTION Keeping up with the hardware has been hard ,…
Q: In what ways might you put Queueing Analysis to use in the area of Engineering?
A: Queueing analysis is a mathematical analysis method which is mainly used to predict the length of…
Q: When it comes to purchasing a computer, what kind of questions do people often have in their heads?
A: The inclinations ought to be in the provided request 1.Processor :- This is the brain of your PC…
Q: Write a code to reverse string using reverse function in java
A: In this java based programming question, it is asking for code to reverse string using inbuilt…
Q: Do you believe a digital signature based on RSA can be forged? Explain if you agree or disagree with…
A: RSA digital signature mechanism The RSA digital signature system employs the RSA principle in order…
Q: Prototyping and agile development methodologies may be used to database and application development.
A: Given: Agile development methodologies and methodsAgile development is defined as gathering…
Q: What is the most important function that a firewall is designed to fulfill? I'm running software…
A: Answer: The computer firewall assists us in preventing unauthorised access to our computer system.…
Q: What is the proper procedure for adding a question and answer to an online workbook?
A: Workbook: A workbook is a document that includes one or more worksheets for data organisation. A…
Q: Start by outlining the challenges you'll have while constructing the framework, and then proceed to…
A: Introduction: There are several challenges to overcome while creating an information system, which…
Q: What conclusions and recommendations may be drawn from this research on cybercrime?
A: Illegal activity aimed towards or involving a computer, computer network, or networked device is…
Q: Q1- Write computer subroutine program doing arrangement three values in ascending then print the…
A: Answer
Q: Why is phyton so popular in cloud computing? Can you describe why it is favored over other…
A: let us see the answer:- Introduction:- Python is an excellent language for data science and…
Q: Justify the usage of a request for proposal in order to get hardware and software specifications.
A: Answer:
Q: Make note of the two most often used methodologies for system design. In what ways does each…
A: Answer is given below-
Q: 4. Let = (1, 2, 1), 7 (-1,-1,2) and w= (0,3,2). Show that ü, 7 and w are linearly dependent or…
A:
Q: What responsibility should Facebook users have for privacy issues that develop as a result of their…
A: Concerns regarding users' ability to maintain their privacy have grown steadily over the past few…
Q: Identify and explain at least three suggested procedures to organizations, particularly those…
A: Cloud computing has been credited with increasing competition by reducing costs, greater…
Q: As a result, the Cleanroom Software Engineering philosophy promotes defect elimination above defect…
A: The answer is given in the below step
Q: Implement the numerical approximation of √√2 using for loop, (conforming to 12 dec places). 2 X₁ = 1…
A: Given:
Q: Write a python mapper and reducer script that would calculate the number of rating records provided…
A: B: Yes, you can use <code>-cmdenv</code> to pass variables to your mapper and…
Q: When working remotely, what are some of the pros and cons of utilizing your own computer vs the…
A: Introduction: Personal computers have advantages and disadvantages when compared to business…
Q: It is important to identify and characterize the five main disciplines of internet governance, as…
A: Internet governance is the development and application by government the private sector, and civil…
Q: When it comes to the purchase of software, it is important to differentiate between the conventional…
A: In this question we will compare between conventional development method and web based development…
Q: How can the ARP protocol let a host A deliver a datagram to its destination B if A does not know B's…
A: ARP protocol: One of the most important TCP/IP protocol suites is the ARP. It's used to assign an…
Q: What problems have been detected in the router's layer 2 protocol? What ramifications does this find…
A: Layer Two Protocol Problems: The Data Link layer is the second tier of the OSI architecture. It…
Q: You are required, in your role as a network trainer for a big organization, to provide a…
A: To forward or filter Ethernet frames, the switch consults a source address table (SAT) before…
Q: Rand generates random values.
A: The program is written in C++. Check the program screenshot for the correct indentation. Please…
Q: 1 Hashing 1. Write a program to use typecasting to create Hash Map,hash function h(x) = x mod 10 and…
A: // Java Program to Implement Hash Tables with Linear Probing // Importing all classes from//…
Q: Discuss what is meant by the term "software engineering," as well as the significance of taking into…
A: Answer: Software engineering is a computer science subject concerned with the design and development…
Q: What role does information technology play in the design, implementation, and analysis of…
A: INTRODUCTION: Here we need to tell the role of information technology in the design, implementation…
Q: Compare the differences between the designs of Borg and Mesos.(Please compare the differences and…
A: Introduction: Cluster scheduling has a long history and predates the concept of big data. There is…
Q: Discuss the usage of buddy functions, when to use them, and how to specify them at build and run…
A: Introduction: Discuss the usage of buddy functions, when to use them, and how to specify them at…
Q: Define the term "software engineering," and then discuss the significance of incorporating software…
A: Software engineering is a subfield of computer science that focuses on the planning and creation…
Q: When it comes to the architecture of software systems, performance and security may seem to be…
A: Performance and security may seem contradictory non- functional goals when architecting software…
Q: ARP only allows a single network to resolve addresses. Could ARP use an IP datagram to submit a…
A: Answer: The Address Resolution Protocol (ARP) sends out a request packet to every computer on the…
Q: Create a quadratic equation solver module that would write the inputs of the user and the…
A: Find Your Answer Below
Q: Please enumerate the qualities that distinguish well-designed service systems.
A: A service system is an organization's setup of technology and other networks. It is done for the…
Q: When it comes to the architecture of software systems, performance and security may seem to be…
A: Given: Supportability, usability, longevity, cost, scalability, reliability, concurrency,…
![refer to the code below
str1="bar"
str2="baz"
for 11 in str1:
for 12 in str2:
x=11+12
x=x[1]
After the program is executed, give the value of x](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F9d6270f5-936b-4261-9d72-9425da66c382%2F68413c41-b64d-4e72-a84a-75f979d0462a%2Fjiemwpl_processed.png&w=3840&q=75)
Step by step
Solved in 2 steps with 1 images
- (Numerical) Using the srand() and rand() C++ library functions, fill an array of 1000 floating-point numbers with random numbers that have been scaled to the range 1 to 100. Then determine and display the number of random numbers having values between 1 and 50 and the number having values greater than 50. What do you expect the output counts to be?What is error in this codec programing language A store asks you to write a C program to make cash payment easier for cashiers. Write a Cprogram that divides the amount of money entered by the cashier into 200 TL, 100 TL, 50 TL,20 TL, 10 TL, 5 TL, and 1 TL banknotes and shows the number of each banknote. Your programshould have an output as given below.
- 2. Test Scores File: test_scores.py Write pseudocode for the main() part of a program that asks the user to enter 4 test scores between 0 and 100, then displays a JCU grade for each score and also the average test score. When you have written the pseudocode for main, implement your solution in Python code and test it with a range of meaningful data. Remember that we've done the JCU grades question before, so copy your function from that practical code file. Sample Output Score: 3 Score: 50.5 Score: 66 Score: 100 Score 3.0, which is N Score 50.5, which is P Score 66.0, which is C Score 100.0, which is HD The average score was 54.875 Enhancements When you have that working... We asked for 4 scores. Have a look at your code... did you use 4 as a numeric literal or a constant?Change 4 to 3... Did you have to change the program in more than one place?If so, then you've missed one of the things we've taught...As a strong guideline: if you need to use the same literal more than once, you…Programming Language: Python 5. Write a Python function that will take a positive integer n from the user as an argument and returns 1 if n is prime, and 0 otherwiseProgramming Language: Python 5. Write a Python function that takes a positive integer n as an argument and returns 1 if n is prime, and 0 otherwise
- C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…Write its code:C++ - When analyzing data sets, such as data for human heights or for human weights, a common step is to adjust the data. This can be done by normalizing to values between 0 and 1, or throwing away outliers. For this program, adjust the values by subtracting the smallest value from all the values. The input begins with an integer indicating the number of integers that follow. Ex: If the input is: 5 30 50 10 70 65 the output is: 20 40 0 60 55 The 5 indicates that there are five values in the list, namely 30, 50, 10, 70, and 65. 10 is the smallest value in the list, so is subtracted from each value in the list. For coding simplicity, follow every output value by a space, including the last one.
- NOT using C++ code format Write a pseudocode for the real percentage-to-numerical-grade-equivalent displaying. Only one percentage score can be entered at a time. The grading scale is as follows: example link: (pls follow this one) https://www.code4example.com/pseudocode/pseudocode-examples/C++ CODE ONLY: Write a program that takes as input five numbers and outputs the mean (average) and standard deviation of the numbers. If the numbers are X₁, X2, X3, X4, and x5, then the mean is X = (X1 + X2 + X3 + x4 + x5 ) / 5 and the standard deviation is: (x₁−x)²+ (x₂-x)²+ (x¸¯x)²+(x¸−x)²+(x¸¯x)² S = 5 Your program must contain at least the following functions: 1. a function that calculates and returns the mean; and, 2. a function that calculates the print standard deviation. Input 1.5 integers Output Enter five numbers: 2 3 9 10 11 The mean is 7.00. The standard deviation is 3.742. Enter five numbers: 7 7 8 9 11 The mean is 8.40. The standard deviation is 1.497.Note:solution using c++ language Pre-Lab 01: Write a program that reads a positive integer x from the user. If x is even, the program prints all the odd numbers between 1 and x – inclusive - each on a separate line. If x is not even, the program prints all the numbers that are multiples of 4 between 1 and x+10 -inclusive -, each on a separate line. Note: As long as the user does not enter a positive number, the program will repeatedly ask the user to enter a positive number. The program must also print an error message "Error- TRY AGAIN – You should enter a positive integer to continue". Úe do.. while to insure the user input.
