Refer to the relative proportions diagram in the first picture. 1. To help reveal patterns in the data, graph the data from the table on the grid provided (the second picture). 2. Write two inferences based on your observations and analysis of the patterns that emerge from the data. Your inferences should give insight into the structure of DNA. 3. Formulate two or three claims about the data in Part 1. Be sure each claim is supported by the data.

Refer to the relative proportions diagram in the first picture. 1. To help reveal patterns in the data, graph the data from the table on the grid provided (the second picture). 2. Write two inferences based on your observations and analysis of the patterns that emerge from the data. Your inferences should give insight into the structure of DNA. 3. Formulate two or three claims about the data in Part 1. Be sure each claim is supported by the data.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section14.1: Establishing Dna As The Hereditary Molecule

Problem 1SB

See similar textbooks

Similar questions

If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?
The E. coli genome contains 1009 Chi sequences. Do these sequences occur at random, and, if not, how much more or less frequently than random do they occur?
Assuming the average weight of a deoxynucleotide monophosphate (dNMP) is 327.0 g/mol, how many picomoles of DNA are present in 500ng of a 1000bp DNA fragment?
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. if the given DNA sample was subjected to ion-torrent sequencing, sketch the expected profile of the sequencing output. assume that the sequential flooding of nucleotides follows the order G-C-A-T.
Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: Which types of nucleotide changes (missense or synonyms)cause amino acid changes?
Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: On what basis did the authors conclude that evidence ofhorizontal transfer is absent from their data?
Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: What is meant by ”horizontal transfer”?
2b) If you denatured the random 1000 bp fragments of potoroo DNA by heating them to 95°C. and then cooled them down to 60°C and allowed them to reanneal, you would find that approximately 20% of the DNA fragments renatured very rapidly, another 30% of the DNAfragments renatured moderately rapidly, and the remaining DNA fragments renatured relatively slowly. From these results, whatfraction of the potoroo genome is composed of highly repetitiveDNA? helpful Information
in the DNA of certain bacterial cells, 13% of the nucleotides are adenine. What are the percentages of the other nucleotides?
A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?
Extrachromosomal DNA is critical to the antibiotic resistance found in microorganisms, how do these DNA elements account for this phenomena?