Q: Sequencing. Arrange the following procedures according to the CORRECT manner of preparing products.…
A: Turpuntine emulsion preparation AB AC A B C E
Q: polystysene (styrofoam cue) PerkinElmer Spectrum IR Version 10 6.0 Tuesday March 22, 2022 6:52 PM…
A: IR Spectroscopy tells us about the functional group present in the molecules.
Q: Which infornation does the pre-exponentail factor contain?
A:
Q: 42 Pdlc lo%. Erou,u ce
A:
Q: The obtained plot in the detector of HPLC is called, O peak O bell O triangle area
A: HPLC stands for high performance liquid chromatography which is a separation technique and the…
Q: (b) What is E-factor?
A: E - factor is used in Green chemistry which is a ratio of total mass of waste and mass of product.…
Q: armethiyl cyclohesamnd (rasewie) 100- 95- 90- 85 80 75 70- 65 60- %Transmittance 3353.38 2924.04…
A: Infrared spectroscopy is used to study and identify functional groups present in solid, liquid, or…
Q: 100 - MS-NU-3528 80 60 40 20 - uluwlwylpwbwwlywu 10 30 40 50 60 70 80 90 100 110 120 m/z Relative…
A: A mass spectrum is an important tool for the determination of the mass of a compound. A mass…
Q: Ref ranges Results 3,7 mg/dl 35mg/dl 12.5 ml/min Tests Creatinine Females <1.2 BUN 5-20 Creatinine…
A: A 60-year-old woman with a history of rheumatoid arthritis, smoking of 60 packs/year, chronic…
Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…
A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…
Q: 1 Use the regression coefficient of an offspring on the mid-parent to estimate
A: This section and the two next parts explain three typical ways for calculating the narrow-sense…
Q: -19-0 Jame tyl acetate onditions o data available. pectrum Summary pectrum ID IDAS412 Epectrometer…
A:
Q: Please answer this both Mcq
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: what ins the major Beduct PH = 4.5
A: To find major product
Q: Hello, I would like help with problem 41 in the image attached.
A: Since you have posted a question with multiple sub-parts,we will solve first three sub-parts for…
Q: AICI3 a) d)
A: Carbocation always have tendency to rearrangement.
Q: 2. Give the answer with correct sig.figs.: 332.57 +24.668 x 2.38
A: The order of operations is a rule that tells the correct sequence of steps for evaluating a math…
Q: A) [He]2s°2px²2py 2pz' B) [He]2s²2px²2py'2pz? C) [He]2s²2px'2py 2pz? D) [He]2s²2px²2py? E)…
A: out of the following options OPTION D violates hunds rule i.e. [He] 2s2 2px2 2py2
Q: D X F C E F Figure 1. Paper Chromatogram Pigments X F E Rf Values 0.15 0.32 --
A: C is called TLC plate or Thin Layer Chromatography plate.
Q: A protein consists of two types of peptide chains (A and B) with an unknown stoichiometry (AxBy).…
A: Given that: peak area of A = 500,000 peak area of B = 100,000 molecular mass of A = 25,000…
Q: A student performed a chromatography experiment to determine the Rf value of an unknown amino acid.…
A: The Rf value ( retention factor) of a compound is defined as the ratio of distance travelled by the…
Q: For an enzyme reaction followed spectrophotometrically at 340 nm the Vmax was calculated at 0.14…
A: Mass of enzyme in cuvette = 30 ng = 30 X 10-9 g
Q: What is the difference between Mohr and serological pipette?
A: Difference between Mohr and serological pipette is given below.
Q: 2. Usé thè linear regression équation ànd the fóllowing Abs 595 dată and dilution factors för…
A:
Q: 1. Please explain the difference between parallel and antiparallel B sheet. Which one has tp…
A: As per the guide line, Since you have asked multiple questions, we have solved the first question…
Q: +Protein Mr pI 12,000 28,000 42,000 66,000 (a;) 103,000 (a2) 111,000 А В 8.4 C 7.2 9. E 5 F 4.2…
A: Size exclusion chromatography is an analytical technique that separates the components of a mixture…
Q: Proide corect prodsct noreacticn. Ho
A: Aqueous KOH upon heating react with a alkyl halide to give an alkene which is possibly a more…
Q: 2.79x10-39 D) ZnS, K:
A: Dear student I have given answer to your question in the image format.
Q: 23.4 Edit Laboratory temperature ("C) Concentration (M) of stock Fe(NO,), solution 0.0020 Edit…
A: The percentage transmittance for trial 1, trial 2, trial 3 and trial 4 is 15.6, 21.6, 28.6 and 40.8,…
Q: The following data were obtained from a Bradford assay to determine the protein content in a sample:…
A:
Q: B Given the chromatogram from a simple paper chromatography experiment, which statement is TRUE? O…
A:
Q: Five blood samples got these :results 0.760 ,0.751,0.752 ,0.756 ,0.752 ppm The standard deviation of…
A:
Q: The mass of a protein was determined to be 92.7 kDa using matrix assisted laser…
A: The relation between kDa (Kilodalton) and Kg (Kilograms) 1 kDa = 1.661 × 10-24 kilogram By using…
Q: In proteomics, peptidomics (and the other -omics techniques), hyphenated MS techniques are used, and…
A: Since you have asked multiple questions, we will solve first one for you. For remaining questions,…
Q: what is the resolution
A: Resolution measures the number of pixels in a digital image or display. It is defined as width by…
Q: or non provid- a) PCI- c) OF
A: This question is related to Lewis structure.
Q: state the difference between a primary and secondary fragment ion. Do not copy.thanks
A: In mass spectroscopy, a high energy ion source is bombarded upon the sample in an ionization chamber…
Q: Does CI aroms have an isotopic pattern of 1:1 relative intensity of M and M+2. True or False?
A:
Q: Following the Kjeldahl procedure, calculate the % protein content of a flour sample by considering…
A: % N = [(ml of standard HCl -ml of blank HCl)*N of HCl* atomic weight of N / weight of sample in…
Q: HO- 1) DMSO, (COCI) 2) Et,N Edit
A: The given reaction is oxidation of primary alcohol to an aldehyde by using swern reaction. The…
Q: 10. C4H,Br 100 80- 68- 42 20- 2922 8L82 1379 602T 1151
A: Degree of unsaturation of C4H9Br is as DU = 4-92-12+1=5-102=0NO degree of unsaturation…
Q: (b) Protein concentration can also be determined by UV spectrophotometry. (i) Describe the principle…
A: Answer. UV spectrophotometry or UV-Visible spectroscopy is an analytical technique used to identify…
Q: Bi-214 --> He-4 +
A: Answer:- This question is answered by using the simple concept of radioactive reaction in which…
Q: स 3. पG तnale ठेवतानe ० Pcतेवकাट प्न न एलकतिवबानकाट वते was melted व+ नि2 K, c4\c५ Rlc रमट Chamge in…
A:
Q: How can the mass transfer "C" term be reduced? a. increase the flow rate b. reduce the size of the…
A: In chromatography, The resistance presented during the mass transfer in between the mobile and…
Q: Give answer. ASAP
A: Given are two compounds and we will have to draw the lowest energy conformer in newman projection.…
Q: Calculate the amount of phycocyanin in Sample 1 in mg where A620=0.211 and A650=0.086, taking into…
A: Phycocyanin is a protein-pigment complex that belongs to the family of phycobiliprotein. It is a…
Q: In SDS page, the elute from the column first. proteins will move through the gel fastest and first,…
A: SDS page and size exclusion chromatography are methods to separate proteins . In SDS page, charged…
Q: the
A:
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 3 images
- Hexane (C6H14, density = 0.766 g/cm3), perfluoro-hexane (C6F14, density = 1.669 g/cm3), and water are immiscible liquids; that is, they do not dissolve in one another. You place 10 mL of each in a graduated cylinder, along with pieces of high-density polyethylene (HDPE, density = 0.97 g/cm3), polyvinyl chloride(PVC, density = 1.36 g/cm3), and Teflon (density = 2.3 g/cm3). None of these common plastics dissolves in these liquids. Describe what you expect to see.A student checked the accuracy of two standard top-loading balances by testing them with a standard 5.000-g mass. The results were as follows: Balance 1: 4.99 g, 5.04 g, 5.03 g, 5.01 g Balance 2: 4.97 g, 4.99 g, 4.95 g, 4.96 g Calculate the average values for balances 1 and 2 and calculate the percent error for each. Which balance is more accurate?Many times errors are expressed in terms of percentage. The percent error is die absolute value of the difference of the true value and the experimental value, divided by the true value, and multiplied by 100. Percenterror=truevalue-experimentalvaluetruevalue100 Calculate the percent error for the following measurements. a. The density of an aluminum block determined in an experiment was 2.64 g/cm3. (True value 2.70 g/cm3.) b. The experimental determination of iron in iron ore was 16.48%. (True value 16.12%.) c. A balance measured the mass of a 1.000-g standard as 0.9981 g.
- The density of an irregularly shaped object was determined as follows. The mass of the object was found to be 28.90 g 0.03 g. A graduated cylinder was partially filled with water. The reading of the level of the water was 6.4 cm3 0.1 cm3. The object was dropped in the cylinder, and the level of the water rose to 9.8 cm3 0.1 cm3. What is the density of the object with appropriate error limits? (See Appendix 1.5.)Perform the following mathematical operations, and express the result to the correct number of significant figures. a. 2.5263.1+0.4700.623+80.7050.4326 b. (6.404 2.91)/(18.7 - 17.1) c. 6.071 105 - 8.2 106 - 0.521 104 d. (3.8 1012 + 4.0 1013)/(4 1012 + 6.3 10l3) e. 9.5+4.1+2.8+3.1754 (Assume that this operation is taking the average of four numbers. Thus 4 in the denominator is exact.) f. 8.9258.9058.925100 (This type of calculation is done many times in calculating a percentage error. Assume that this example is such a calculation; thus 100 can be considered to be an exact number.)A certain analytical method for the determination of lead yields masses for lead that are low by 0.5 g. Calculate the percent relative error caused by this deviation for each measured mass of lead. Report the percent relative error with the correct number of significant figures. 838.6 g lead: 332.8 g lead: 68.0 g lead: % relative error % relative error % relative error
- In a certain population, body weights are normally distributed with a mean of 152 pounds and a standard deviation of 26 pounds. How many people must be surveyed if we want to estimate the percentage who weigh more than 180 pounds? Assume that we want 96% confidence that the error is no more than 4 percentage points.A student performed an analysis of a sample for its calcium content andgot the following results: 14.92% 14.91% 14.88% 14.91%The actual amount of calcium in the .sample is 15.70%. What conclusions can you draw about the accuracy and precision of these results?What is the smallest mass that we can measure on an analytical balance that has a tolerance of ±0.1 mg, if the relative error must be less than 0.1%?
- 3. A method of analysis yields masses of gold that are low by 0.4 mg. Calculate the percent relative error caused by this result if the mass of gold in the sample is a. 500 mg b. 250 mg c. 60 mg 4. The method described above is to be used for the analysis of ores that assay about 1.2% gold. What minimum sample mass should be taken if the relative error resulting from a 0.4-mg loss is not to exceed a. -0.1% b. -0.8%graduated cylinder weighs 35.825 g. When 10 mL of water is measured in it, the weight of the graduate and water is 45.835 g. Calculate the weight of the water, and express any deviation from 10g as percentage of error.In order to find the density of a solution of unknown density, 10 mL of solution was drawn into a clean and dry beaker three times with a pipette and weighed and the weighing results were found to be 65.1452 g, 64.9982 g, 65.1027 g. Calculate the density of the solution and the standard deviation of the measurements, since the empty weight of the beaker is 52.2461 g.