Review translation. Match the term and its description. Each term can only be used once. transfer amino acids to the growing polypeptide in a ribosome | Choose these base-pairs of a tRNA with a complementary codon on MRNA | Choose ) The two ribosomal subunits (large and small) are made of proteins and this RNA called | Choose >

Review translation. Match the term and its description. Each term can only be used once. transfer amino acids to the growing polypeptide in a ribosome | Choose these base-pairs of a tRNA with a complementary codon on MRNA | Choose ) The two ribosomal subunits (large and small) are made of proteins and this RNA called | Choose >

Name: [ChooseJ(Choose]ncode more than one kind of polypeptide,ch segments a
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: [ChooseJ(Choose]ncode more than one kind of polypeptide,ch segments are treated as exons during splicingdomainsalternative RNA splicingea modular architecture consisting of discreteగboames Question 7Review translation. Match the term and its descrip

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 6P

See similar textbooks

Similar questions

Be sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a. His-Cys-Tyr-Val-Ser 5¹- b. Phe-Val-Thr-Tyr-Glu 5'- 5'- c. Trp-Phe-Asn-Gln -3' U -3' с Table 26.2 The Genetic Code-Triplets in Messenger RNA First Base (5' end) -3' U UUU UUC UUA UUG CUU CUC CUA CUG AUL Phe Phe Leu Leu Leu Leu Leu Leu la C UCU UCC UCA UCG CCU CCC CCA CCG Second Base A UAU UAC UAA UAG CAU CAC CAA CAG Ser Ser Ser Ser Pro Pro Pro Pro Tyr 55 Tyr Stop Stop His His Gin Gin G UGU UGC UGA UGG CGU CGC CGA CGG Cys Cys Stop Trp Arg Arg Arg Arg Third Base (3¹ ond) DUAC DU AG с А А
AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remain
Typed explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'
TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.The 2 subunits of DNA PoI II are called clamp loader and sliding clamps. 2. In eukaryotes, replication and transcription occur in the nucleus, while translation occurs in the cytoplasm.
Question 2 Match the term and its description. Each term can only be used once. a series of nonoverlapping, three-nucleotide words [Choose J This DNA strand provides a template for ordering the sequence of complementary nucleotides in an RNA transcript | Choose ) the MRNA base triplets [ Choose J Codons must be read in the correct groupings in order for the specified polypeptide to be produced. These correct groupings are [ Choose J called > > > >
Question:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to the right of the sequence, and translation must start from the start codon. Include 3' and 5' for RNA transcript and N- and C- terminus in your final peptide sequence. Use the 1-letter form of amino acids when writing the sequence of polypeptide 5' CCCCAGCGTAAGTTTATGGTTACTCATGAA 3' 3' GGGGTCGCATTCAAATACCAATGAGTACTT 5'
TATA box is located . Question 11 options: upstream from the initiation site downstream from the initiation site within intron sequence within exon sequence
Please also help with this one . I am not sure what to do when I encounter a STOP codon.
Translation. Write the anti-codon sequence of the MRNA transcript. Translate the MRNA transcript into peptide sequence using both the 3 letter abbreviation and 1 letter abbreviation. ANTI-CODON 3' 5' SEQUENCE AMINO ACID N- C- SEQUENCE (3 letter terminus Abbreviation) Terminus AMINO ACID N- C- SEQUENCE (1 letter terminus Abbreviation) Terminus
RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…
Answer codon usage based on this description: You have isolated a new eukaryotic microorganism and want to determine the genetic code of its mitochondria. Here are the amino acids encoded after translation of two synthetic mRNAs using mitochondrial extracts from your eukaryote- in this experiment translation can start at any sequence position: RNA: Protein: Tyr-Met-Tyr-Met-Tyr-Met---- UAUAUAUAUAUAUAU--- UAAUAAUAAUAAUAA--- Asn-Asn-Asn-Asn-Asn---- Met-Met-Met-Met-Met---- Based on the results shown here, what can you conclude about the codons in this eukaryote? A. B. C. D. O A O C OD OB AUA Tyr Met Tyr Met UAU Met Tyr Met Tyr AAU Met Trp Asn UAA Asn Asn Asn Asn, STOP or Met Asn, STOP or Met
Multiple choice A. The role of tRNA in translation is to be translated by a ribosome. incorporate into a polypeptide chain. attach amino acids to a polypeptide chain. carry amino acids to the ribosome. Multiple choice B. Translation continues until the ribosome falls off the end of the RNA. the ribosome encounters a transcriptional termination site. the ribosome encounters a stop codon. the ribosome falls off the DNA.