Select all that would be true if I had a nonsense mutation in an exon of a gene: The nonsense mutant allele would be the same size as wildtype by PCR-electrophoresis The nonsense mutant protein would be the same size by Western as the wildtype protein The nonsense mutant allele would be a different size compared to wildtype by PCR- electrophoresis The nonsense mutant protein would be a different size by Western compared to the wildtype protein
Q: Describe the function of the ribosome in two sentences.
A: Ribosomes are cellular organelles made of proteins and RNA that translate genetic information into…
Q: Question 1: Now complete the sketch for an XY human male cell undergoing spermatogenesis if a…
A: The term "cell division" refers to the process of division of a parent cell into its daughter cells.…
Q: Tamoxifen is the cancer drug you read about at the beginning of the lesson. Predict five bonds that…
A: Cancer drugs (Tamoxifen) is used in cancer treatment to stop uncontrolled cell growth.Polar bonds…
Q: EXERCISE 3 PHASES OF MITOSIS The phases of mitosis depicted are out of order. Work with a group of…
A: To maintain the overall quality of life, the cells are being formed, repaired and moved into…
Q: The image below shows a karyotype made from a male of a new diploid eukaryotic species. Answer the…
A: First, let's answer each one by one,Ploidy of the cell used to make the karyotype: DiploidA diploid…
Q: How do advocay groups influence chronic disease programs
A: The objective of the question is to understand the role and influence of advocacy groups in shaping…
Q: One liter of Hartmann’s solution is to be given over 12 hours. Calculate the flow rate of a…
A: Hartmann's solution which is also known as Compound sodium lactate. It is used as a replacement of…
Q: 8. According to the most recent model of the evolution of eukaryotes, how did the first eukaryote…
A: The current model of eukaryotic evolution is largely based on the endosymbiotic theory. According to…
Q: what plant-based drug would you be the most worried about if it becomes truly legalized? Justify…
A: Solution)The potential legalization of plant-based drugs raises concerns, with psilocybin-containing…
Q: Several alternative definitions of the term species have been proposed, recognizing different…
A: The objective of the question is to determine whether the existence of multiple definitions of the…
Q: How would self-sacrifice of male redback spiders be an adaptive behaviour?
A: (a) Enzyme activation:explanationIncorrect self-sacrifice is not linked to activated enzymes for…
Q: If an OD=1.0 culture yielded a plate count of 2.2 x 107 cfu/mL. What is the cell count of an OD=0.5…
A: Answer: The relationship between colony-forming units per millilitre (cfu/mL) and optical density…
Q: refers to drug craving. Select one: a. agonism b. psychological dependence c. Schizophrenia d.…
A: Agonism and Antagonism are the interactions of a particular substance or drug with receptors present…
Q: The plaque assay plate below was made from a dilution of 10-7 and 0.1 ml of the dilution was plated…
A: The objective of the question is to calculate the virus titer in PFU/ml (plaque-forming units per…
Q: 1) Define internal myopia, external myopia, normative myopia and de facto myopia. Here I am looking…
A: This refers to a lack of understanding or awareness of one's own limitations, biases, and internal…
Q: 60 individuals have the genotype AA 28 individuals have the genotype Aa 12 individuals have the…
A: The proportionate representation of a particular gene variant (allele) within a population is…
Q: If a population has the following number of individuals: AA=3 Aa=2 aa=0. What is the (observed)…
A: The objective of this question is to calculate the observed frequency of each genotype and each…
Q: Aorta labels: tunica intima, tunica media, tunica adventitia, smooth muscle, nuclei. I need help…
A: There are three types of blood vessels in the cardiovascular system: arteries, veins, and…
Q: Mark invited Kenny to play in his member-guest golf tournament at his new country club. The…
A: The gastrocnemius is a flexor muscle of the leg that flexes the leg at the knee. It plays an…
Q: QUESTION 6 For the following pedigree, assume that the mode of inheritance is autosomal recessive,…
A: As it is autosomal recessive, the next generation will be unaffected.Fill the answer on the…
Q: 3. Cancer is a disease related to uncontrolled cell division. Investigate two known causes for these…
A: Cancer is a disease related to uncontrolled cell division. Apoptosis, a normal process of cell…
Q: Phytoplankton is most frequently found in which of the following zones of an ocean?…
A: The question is asking us to identify the zone of the ocean where phytoplankton is most frequently…
Q: If two chromosomes of a species are the same length and have similar centromere placements and yet…
A: SolutionC) Loci are differentThe term locus refers to the specific physical location of a gene or…
Q: This question is about cells & organelles. Why do you think there was so much emphasis put on those…
A: When we delve into the world of biology, cells, and organelles often receive much of the initial…
Q: Most organisms' niches are controlled by Genetic trait for adaptive characteristics Luck Behavior…
A: Solution)The primary factors controlling most organisms' niches are-1) Genetic traits for adaptive…
Q: Consider the table below. What is the TDT for E. coli at 70 C? Please include the unit.
A: The image displays a table showing the lethal effects of heat on E. coli at various temperatures and…
Q: Which of the following intervals is most likely to vary when the heart rate changes? QRS complex…
A: Thе intеrval most likely to vary whеn thе hеart ratе changеs is thе P-R sеgmеnt (option A). Thе P-R…
Q: Yeast have 8 similar tRNA genes with the anticodon 5'-GUA. A researcher mutates one of these genes…
A: Original Codon Decoded: The complementary codon to the anticodon was first decoded by the tRNA…
Q: Q1 One group of scientists provided a statement quoted in the figure shown. about the fossil recora…
A: Fossils are the preserved remains or traces of organisms that lived in the distant past. They…
Q: 2. Let's assume you did a dihybrid cross of homozygous dpy-5 hermaphrodites and homozygous him-5…
A: A dihybrid cross involving two separate genes is described in this scenario:dpy-5: Body form is…
Q: Which of the following could you categorize as plankton? O Fish larvae O Jellyfish O Diatoms…
A: Generally speaking, plankton refers to a broad category of mostly minute aquatic creatures suspended…
Q: Which type of competition does not happen between members of the same species?…
A: The question is asking to identify the type of competition that does not occur between members of…
Q: In the experimental setup described in the attached figure (Figure 2.5 of the textbook), the middle…
A: The question is asking what would happen if the KCl solutions in a two-compartment setup were…
Q: If 60 individuals have the genotype AA, 28 individuals have the genotype Aa, and 12 individuals have…
A: The objective of this question is to calculate the frequency of the 'a' allele in a population given…
Q: a Imagine that creatine phosphate, rather than ATP, is the universal energy carrier molecule in the…
A: Creatine phosphate cannot be a universal energy carrier molecule in the human body as it is an…
Q: You are studying the inheritance pattern of hair color in troll dolls, which have XY sex…
A: Answer:- True-breeding blue-haired male (XY) crossed with true-breeding orange-haired female…
Q: cip sequence rule in ephedrine
A: CIP sequence rule in ephedrine, It's important to note that the CIP (Cahn-Ingold-Prelog) rules are a…
Q: Three genotypes occur in a population of birds: DD, Dd, and dd. D is the dominant allele, and…
A: The selection coefficient represents the reduction in relative fitness of the genotype or how much…
Q: Choose the correct option as the degree of unsaturation in a fatty acid increase Melting point…
A: The degree of unsaturation in a fatty acid refers to the number of double bonds present in the fatty…
Q: If you transferred 15 mL of an undiluted sample into 35 mL of diluting fluid, what dilution have you…
A: The objective of this question is to calculate the dilution factor of a solution when a certain…
Q: You have two cell lines named ViRa and SaSi growing in your lab. ViRa is susceptible to poliovirus…
A: The question is asking about the production of infectious virus in two different cell lines, ViRa…
Q: From the images, what can you infer about the wings of the bat and the butterfly?
A: Understanding the anatomical features of various winged creatures provides valuable insights into…
Q: Fill in the blank with metric prefixes (not abbreviations): 103 seconds: 1 blank gram
A: Metric prefixesTo indicate decimal multiples or fractions of units of measurement, the metric system…
Q: a. Match the FST to the subset of populations below. In each answer describe in your own words if…
A: Fst = ( variation between populations)-( variation within populations)/ variation between…
Q: Phycobiliproteins are complex proteins in cyanobacteria that absorb light energy. There are three…
A: The green substances that present in all plants and that give plants their green color and help the…
Q: Question 5 Which of the following is a feature common to both Argonaute and Cas9? Forms a complex…
A: Argonaute proteins are highly conserved in almost all organisms. They not only involve in the…
Q: AUG is the most common start codon found in translated genes. Which of the following is true of…
A: The start codon is the initial set of codons in an mRNA transcript that is translated by a ribosome.…
Q: Desert owls are inactive during the day and active at night. They also have small bodies. This…
A: The question is asking us to identify the type of adaptations that desert owls have developed to…
Q: P-bodies are... Sites of protein phosphorylation. Loosely organized protein aggregates involved in…
A: Processing bodies (P-bodies) are cytoplasmic ribonucleoprotein (RNP) granules primarily composed of…
Q: What is an iodine number and what does it indicate?
A: Iodine Number:The degree of unsaturation in fats and oils is determined by the iodine number, also…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Select all that would be true if I had a missense mutation in an gene: The missense mutant protein would be the same size by Western as the wildtype protein The missense mutant allele would be a different size compared to wildtype by PCR- electrophoresis The missense mutant protein would be a different size by Western compared to the wildtype protein The missense mutant allele would be the same size as wildtype by PCR-electrophoresisFor separating DNA of different sizes, you would use Question PCR Questi Gel electrophoresis Restriction enzymes 1 Listen Crispr For making specific DNA changes in living organisms, you would use ** Crispr Restriction enzymes Gel electrophoresis PCR ◄0 Listen You are interested in identifying genes that determine tail length in dachsunds. You analyze the genome of several dachsunds and look for SNPS that correlate with tail length. The results are shown here pog Spot Rover Chase Frisbee Cin Checkers SNP 1 SNP 2 SNP 3 Tail Length (cm) 10 12 SNP 4 9 4 3 10 SNP 1 C C C G C SNP 2 A T T A A T Based on these results which SNP is best correlated with tail length SNP 3 C C C G C SNP 4 G G T T T GSTEP BY STEP Exaplanation would be appreciated so I can understand for upcomming exam. In humans, the COL1A1 locus codes for a collagen protein found in bone. A recessive COLA1 allele believed to reduce bone density and increase risk of fractures differs from the wild type allele by the presence a GT in the first intron of the gene. This mutation can be easily screened by PCR, using COL1A1-specific primers followed restriction enzyme digest of the product with MscI. The normal allele is denoted as G and the recessive allele as T. A recent study of 894 women found that 570 were GG, 291 were GT and 33 were TT. (Assume for this exercise that these values reflect both male and female values for the sampled population. What are the frequencies of each allele? What are the frequencies of each genotype? c. Is this locus in Hardy-Weinberg equilibrium? Use the table below to evaluate the significance of any deviation from H-W expectations.
- The temperature at which the primers and target DNA hybridize may be changed to influence the stringency of PCR amplification. What effect will changing the hybridization temperature have on the amplification? Let's say you have a certain yeast gene A and want to check whether it has a human equivalent. How might managing the hybridization's rigor benefit you?Here is a DNA agarose gel showing PCR products from a mouse genotyping experiment. Genotyping tells us whether each mouse is a wild type mouse (i.e. not genetically modified) or a mutant mouse. Interpret the results for each mouse 1-3.From your knowledge about DNA microarray, answer the following: A- How DNA microarray is created? and why it is referred to as “hybridization technology”? B- Why RT-PCR is important in the sample preparation to perform expression microarray experiment? C- Mention the name and the color of the dyes used in expression microarray? D- If the expression microarray experiment was done with a normal sample and a suspected sample, after reading the color pattern resulted from the experiment it was recorded that “gene A22” is expressed in the suspected sample. The gene A22 is clinically linked to colon cancer. Answer the following: What is the expected color of the spot on the microarray which represents this gene? What is your interpretation of the suspected sample; is it a cancer sample or not and explain why?
- The sequence below shows 140bp of a double-stranded DNA sequence coding for histone H2A. What two primers could be used to amplify the whole 140bp sequence in a PCR reaction? 1 70ATGTCTGGACGTGGCAAGCAGGGAGGCAAAGCCCGCGCTAAGGCCAAGACTCGCTCTTCTAGGGCCGGTCTACAGACCTGCACCGTTCGTCCCTCCGTTTCGGGCGCGATTCCGGTTCTGAGCGAGAAGATCCCGGCCAG 71 140 TCCAGTTCCCCGTGGGCCGAGTGCACCGCCTGCTCCGCAAAGGCAACTATGCCGAGCGGGTCGGGGCCGGAGGTCAAGGGGCACCCGGCTCACGTGGCGGACGAGGCGTTTCCGTTGATACGGCTCGCCCAGCCCCGGCC a. TACAGACCTGCACCGTTC and GGCCGGGGCTGGGCGAGC b. ATGTCTGGACGTGGCAAG and CCGGCCCCGACCCGCTCG c. ATGTCTGGACGTGGCAAG and GCTCGCCCAGCCCCGGCC d. TACAGACCTGCACCGTTC and CGAGCGGGTCGGGGCCGGAbove what amplicon size is this PCR reaction dNTP limited? The reaction contains 35 pmoles of each 24 base primer, 1.2 mM dNTP's and is 40 uL in volume. Answer in base pairs, but don't include the unit in your answerThe image below shows the general structure of a gene on a chromosome. The arrows above and below the chromosome indicate the binding positions of potential forward (F) and reverse (R) PCR primers. Select two primers from the list below that would exclusively amplify exon 3 in a PCR reaction. ut of Intron 1 Intron 2 +1 Poly-A signal ATG TAG F1 Exon 1 F4 Exon 2 F6 Exon 3 R6 R4 R3 R2 R1 Promoter Select all that apply: cross out Da. F1 cross out Ob. F2 cross out Oc. F3 cross out O d. F4 cross out O e. F5 cross out f. F6 cross out g. R1 cross out Oh. R2 cross out OL R3 cross out O. R4 cross out k. R5 cross out R6 TI
- The short sequence shown below is part of a gene of interest. You decide to amplify this part of the gene by PCR. One primer has been provided by your lab supervisor as shown 3 GAGAGC 51 5'TGAGCAGCGATGCCGATGTTGCCAATGCAGCTCTCG-3'| Which of following additional primers would you need to make? OA S'ACTGCT'3 OB. S'ACGAGT3 OC. SUGAGCA'S D. STGAGCA'3For this activity you will draw out the first steps of the PCR reaction, using the following as a short template. Take a picture of your drawing and upload it to this Question. 5' TTGCGTACGTGCATGTGTGCACATATGTCC 3' 3' AACGCATGCACGTACACACGTGTATACAGG 5° In your upload submission be sure to include: 1. Label the 5' and 3' end of the template and each primer, and indicate the direction in which polymerization will take place. 2. Write the sequence of a 10 base pair Forward primer and a 10 base pair Reverse primer binding to the template strand. Add an arrow showing which direction polymerization will take place 3. Add a DNA polymerase to the drawing above showing where the polymerase will bind. 3. Draw and label a DNTP nucleotide. Show how this monomer gets incorporated into a new DNA strand?After running a qPCR experiment, we will have graphs showing the amount of fluorescence detected by the digital camera compared to the number of PCR cycles run. Suppose you see the following graph output by the qPCR machine: Relative Fluoresence 3.0 2.5 2.0 1.5 1.0 0.5 0.0 0 10 20 30 40 50 Cycles Which curve (blue, red, or green) represents a sample with the smallest amount of mRNA present? Why? Be sure to discuss Ct values in your answer.