Q: Iron atoms have been detected in the sun's atmosphere, some with many of their electrons stripped…
A: Atoms are made up of fundamental particles called electrons and protons. Protons have a positive…
Q: Match each of the following terms with the correct definition or explanation. Dragged and dropped…
A: When the phenotypes of the two parents combine to produce a new phenotype in their offspring, this…
Q: Jenny and Joe are heterozygous for green eyes which is recessive. They have 5 children. What is the…
A: In genetics, the laws of Mendelian inheritance determine the likelihood of inheriting a particular…
Q: Work N1. Initial isolation of pure culture aerobic microorganisms from mixture of bacteria mixture…
A: In microbiology, a pure culture is a lab culture that contains only one species of organism. By…
Q: A 35 year old individual is drinking from a gallon water bottle. They feel dizzy upon standing and…
A: Polyuria is a medical condition characterized by excessive urination, in which an individual…
Q: Which factors are associated with sickling of red blood cells in sickle cell disease? high O2…
A: Introduction: Red blood cells (RBCs) are the most abundant type of blood cell and play a…
Q: CELL MEMBRANE VOCABULARY TERMS LIST Use the terms below to fill in the blanks. Cell membrane Lipid…
A: Cell is structural and functional unit of all organisms. The cell was discovered by Robert hooke in…
Q: Ms. Dela Cruz reports to her radiation oncologist that she missed her period for a month and might…
A: Miss Dela Cruz is suffering from cancer and as a part of a treatment plan she is receiving Radiation…
Q: 9. For the following organisms, rank them by the probable percentage of unsaturated phospholipids in…
A: Phospholipids are the Lipid molecules possessing a Phosphate head which is hydrophilic and fatty…
Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…
A: Introduction : One of the earliest steps in gene expression is transcription. The transfer of…
Q: Which of the following equations defines population size? Question 3 options: (Pt+1) = B - I +…
A: Introduction Population size refers to the number of individuals in a specific species or group of…
Q: A couple would like to conceive a child. When should timed intercourse occur? O immediately before…
A: The duration of menstrual cycle is about 28 days. In the menstrual cycle, ovulation generally takes…
Q: What are some organelles that are present in the potato cells that are not in the cheek cell?
A: Introduction :- A cell is the basic unit of life and is considered the building block of all living…
Q: During labor, a baby becomes breech. After a few attempts, the health care provider is unable to…
A: Cesarean or C-section delivery is a surgical method of delivery made through incisions in the…
Q: Situational problem: A cause methylation of g methylguanine. Why a
A: Introduction: DNA (Deoxyribonucleic acid) is the genetic material that provides the instructions…
Q: rotifers feed more on unicellular yeast
A:
Q: Centromeres of a single homologous chromosome are pulled to opposite poles during
A: Introduction :- Centromeres are a region of a chromosome that play a crucial role in cell division.…
Q: of EA, the equilibrium potential of A,
A: 1) The concentration of A- ions is higher inside the cell (100 mM) compared to outside the cell (0…
Q: Stru
A: Introduction: Bones are formed of a variety of cells, proteins, minerals, and vitamins and are…
Q: 5. The solutions in the two arms of the U-tube are separated by a membrane that is permeable to…
A: The net movement of anything (such as atoms, ions, molecules, or energy) from a location of higher…
Q: Which of the following allows the AIDS virus, which contains RNA to insert viral DNA into the DNA of…
A: ANSWER) AIDS is the acquired immunodeficiency syndrome which is caused by the Human immunodeficiency…
Q: strains of Drosophila that have either normal legs or abnormally short legs and you are studying the…
A: Law of dominance says that dominant character is expressed in two conditions either in homozygous…
Q: What will happen if both SRP54 and SRalpha are bound to GTPgammaS instead of GTP? SRP54 and SRalpha…
A: SRP54 and SRalpha are proteins involved in the process of protein synthesis and folding in the…
Q: 41. A 14 year old girl is admitted to the hsopital after taking an overdose of aspirtin. Her plasma…
A: We are given plasma concentration of salicylate after patient took aspirin. The concentration at 6…
Q: Diamond Sex-linked Mt-linked Heterosis III E E Standardized symbol in a pedigree chart representing…
A: The passing of genetic information from the parents to the offspring is called inheritance.…
Q: Explain weather discuss the effects of ageing on the functionality of T cell Discuss wea
A: Introduction: T cells, also known as T lymphocytes, are a type of white blood cell that play a…
Q: What occurs as a result of the joining of sperm and ova? gametes meiosis mitosis zygotes
A: A sperm cell and an egg cell fusing together to create a single cell that contains the genetic…
Q: You will read six articles from databases and assemble an outline, which will be posted in the…
A: Introduction: An artificial womb is a technology used for the growth and development of a fetus…
Q: | 11. Fill in the correct answers below. e. A specific example of a carbohydrate monomer is: ANSWER…
A: Macromolecules are large, substances made up of repeating components such as carbohydrates, lipids,…
Q: The make-up of the microbial community in the leaves of pitcher plants is affected more by the types…
A: Introduction: Adaptations refer to the characteristic features and behaviors that have evolved in a…
Q: Describe and compare human prion infections
A: Ptions are the infectious particles made up of misfolded proteins. Genetic prion diseases are caused…
Q: and the gre
A: Introduction: A Punnett square is a tool used in genetics to predict the expected ratios of…
Q: Assume that you are adding 300 microliters of 1% substrate solution per well in a 24-well plate. If…
A: Fibronectin is a glycoprotein found in the extracellular matrix of cells and is also obtained from…
Q: How does renal tubular disease or renal parenchyma disease affect the excretory and haemodynamic…
A: Renal system or excretory system consists of organs which help in excretion of waste products out of…
Q: 5. The electrochemical gradient can be utilised by ATP synthase to generate ATP - explain how the…
A: Photosynthesis - It is a process in which energy from sunlight is transformed into chemical energy…
Q: All of the following are true regarding the pathogenesis of cancer EXCEPT: the immune response may…
A: Introduction :- PSA stands for Prostate-Specific Antigen, which is a protein produced by the…
Q: What are the main animal body plans and directional orientations?
A: Introduction :- Animal body plans refer to the basic shape or structure of an animal's body and how…
Q: What recommendations would you make to Cass to help her maintain healthy blood sugar levels? What…
A: It is very necessary to maintain healthy blood sugar level. This prevents or delay long-term,…
Q: Fill in the blank space: Foods t
A: Introduction: A nutrient is a substance in food that provides energy, or the building blocks for the…
Q: Place each box in the appropriate column. (Each box is used only once.) Probability of offspring…
A: A dihybrid cross is a cross between two organisms that are exact hybrids for two characteristics in…
Q: provide study and literature about aquaponics use google scholar for articles questions: 1. why…
A: Aquaponics is a method of farming where fish and plants are grown together in a closed-loop system.…
Q: How many uL of DNA would I load into my gel if I am given a stock of 450ug/mL and I want to load…
A: Introduction :- DNA, or Deoxyribonucleic Acid, is a long, double-stranded molecule that carries the…
Q: Defend or refute this statement: The upper-temperature limit to life is unrelated to the stability…
A: Bioremediation is a process that is often used to degrade or eliminate the harmful waste from the…
Q: Consider the B locus which has two alleles in a population: B and b. Researchers examined the…
A: In population genetics, the Hardy-Weinberg principle, often referred to as the Hardy-Weinberg…
Q: Pseudomonas Алхидейша E. Coli мусорвията Pneumonia Clostridium Botulinum 79% 65% 52%
A: The history of the events by which species of other taxa successively evolve from their common…
Q: Relative to other unicellular protists, how would you characterize the size of amoebas?
A: Amoebas are single-celled organisms that can be found in sewage, polluted water, streams, lakes,…
Q: 000 autosomes centromeres centrosomes gamete 1000 chromatid ooctyes meiosis I interphase The part of…
A: Cell cycle plays a very important role in living organisms. Along with cell division, cell growth…
Q: Newborns spend the majority of their time O playing O crying O sleeping O eating
A: A Newborn also called a neonate refers to a baby under the age of 28 days. However, some define…
Q: DNA synthesis occurs. The cell grows or enters a state of growth arrest. The cell grows and…
A: Introduction Cell division is the process by which a single cell divides into two or more daughter…
Q: 15.Which of these structures secretes digestive enzymes that aid in the digestion of carbohydrates,…
A: Organ systems are collections of organs that cooperate to perform certain tasks for the organism.
i need a visual reprensentation of what i need to do please
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 6 images
- After mitosis, each daughter cell contains genetic instructions that are ______ and _____ chromosome number of the parent cell. a. identical to the parent cells; the same b. identical to the parent cells; one-half the c. rearranged; the same d. rearranged; one-half theplease explain this in a length of a full page as much detail please 1.What are the primary functions of cell division (Mitosis) as compared to Meiosis, how are the daughter cells produced in each process different?9. Complete the following table comparing mitosis and meiosis Mitosis Meiosis Number of chromosomal duplications Number of cell divisions Number of daughter cells produced Number of chromosomes in the daughter cells How the chromosomes line up during metaphase Genetic relationship of the daughter cells to the parent cell Functions performed in the human body.
- 2) What stage of mitosis is shown in the photo? Give a reason for your answer.Only some cells derive from a mitosis event.. 1. Which statement is most correct regarding the difference between mitosis and meiosis? O Meiosis can produce any cell type, while mitosis can only make gametes (sperm/egg cells) * Mitosis essentially clones a cell (makes an identical copy), while meioisis is a ma O complex process that divides up a cell's set of chromosomes into gametes (sperm/egg cells) ODNA replication is required for mitosis but not for meiosis ODyads are seen in mitosis but not meiosis 2 What distinguichon hon1. In 3 sheets of bond paper, draw the mitosis, meiosis 1 and meiosis 2. 2. Fold each sheet into four and draw the mitosis, meiosis 1 and meiosis 2 on each sheet.'s folds. 3. If the mother cell has 10 chromosomes, draw the stages of mitosis, meiosis 1 and meiosis 2 using blue and red pencils only for the chromosomes.
- 8) What is produced after mitosis? 4 identical somatic cells 2 different (non-identical) somatic cells 2 identical somatic cells 4 different (non-identical) gametesA cell has n=2. How many total chromosomes are in a diploid cell? b. Draw this cell during metaphase of mitosis:below you will sketch the difference between cells that go through mitosis versus meiosis. the focus is on the number of chromosomes, not the specific steps, so you only need to draw the chromosomes in each circle. do this drawing for a fruit cell, whose body cells have 8 chromosomes or 4 homologous pairs. MITOSIS 11 AFTER S PHASE OF INTERPHASE AFTER PMAT AND CYTOKINESIS od MEIOSIS KO AFTER S PHASE OF INTERPHASE AFTER MEIOSIS I AFTER MEIOSIS II KA Q B)
- Use the diagram to identify one similarity and one difference between mitosis and meiosis. Your answer must specifically refer to this diagram. [i.e. say what specific cells in the diagram show the similarity or difference] Mitosis Parent cell Meiosis Parent cell DNA replicates DNA replicates 2 daughter cells 2 daughter cells 4 daughter cells U.S. National Library Medicine (Level 3) МacBook Air DD DII F10 F7 F4 F2 & @ 9. 7 8. 2 3 4 { P Y U W E R J K G D C V option command command .. .. B9. Complete the chart below comparing the process of mitosis to meiosis. mitosis meiosis Purpose #cell divisions (1 or 2) #cells produced (2 or 4) Are new cells gametes or somatic cells? Are new cells haploid or diploid? Does crossing over occur? When? Are new cells genetically identical or Different than parent cell?List down at least 4 differences between Mitosis and Meiosis 2. With a simple sketch, using colored pens provide an illustration (with label) of the cell that will show the comparison of: 1. Anaphase 1 and Anaphase 2 2. Metaphase 1 and Metaphase 2