Answered: Termination of translation UAA E PA 5'…

Termination of translation UAA E PA 5' 3' RF1 RF1 AUA A Peptidyl--RNA cleavage RF1 FIGURE 9-17 Translation is terminated when release factors recognize stop codons in the A site of the ribosome.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 16RQ: The RNA components of ribosomes are synthesized in the.____ cytoplasm nucleus nucleolus endoplasmic...

See similar textbooks

Related questions

Q: What is/are the sensory structure/s present in jellyfish? What is/are it/they for

Q: As a result of global warming, what evolutionary changes could we infer might eventually be seen in ...

A: Introduction:- Long-term changes in temperature and weather patterns are referred to as climate chan...

Q: To discuss: The value of genome projects.

A: Recombinant DNA technology (rDNA technology) is extremely useful for analyzing a species' entire gen...

Q: Which of the following accurately describes the structure of the DNA molecule? contains four bases a...

A: Introduction :- DNA is the molecular name for the molecule in all living things that conveys genetic...

Q: Monkeys and apes share one trait with birds that is unusual among other mammals. It is … Group of ...

A: Primates are distinguished from the other mammals by one or more of the following traits like unspec...

Q: What are all of the checkpoints found in interphase and mitosis and what are their functions/purpose

A: Eukaryotic cells follows a cyclical events during cell division that is known as cell cycle that con...

Q: what the downward and upward slopes in the graphs indicate about the contractile vacuole?

A: The contractile vacuole gathers and pumps out excess water as it accumulates in the cell.

Q: SPECIMEN LEAF MODIFICATION SPECIALIZED FUNCTION Allium cepa Leaf base: Leaf stalk: Shape of leav...

A: Allium cepa It is commonly known as an onion or bulb onion. It is a vegetable and is the most cultiv...

Q: How is protein made out of a RNA template?

Q: D E -E ET

A: Rats share many common similarities with humans and they both are mammals. This is the reason most o...

Q: a. In fruit flies, gray is dominant over black. If a purebred gray fruit fly crosses with a black fr...

A: Dominant and recessive are the two types of trait that express themselves at different gene level.

Q: Which cells are harvested from the early embryo for stem cell research? O enucleated cells umbilical...

A: 23 Answer is all blastocyst cells

Q: Collecting data that can then be transformed into a bacterial growth curve is usually done using a s...

A: A spectrophotometer is an instrument used to measure the amount of light absorbed by a sample. The m...

Q: 1. How many copies of an X-linked gene does a male have? 2. Will a male be able to give his X-linked...

A: DISCLAIMER : Since you have posted a question with multiple sub-parts, we will solve first three sub...

Q: 토 25 2 Numbers per km? (Б) 70 50F 40 125 100 75 50 400 800 1200 Density (m³) w 6) ssewoig * (wo) y1b...

Q: Differentiate Classical Genetics and Molecular Genetics

Q: We discussed four types of lipid movements in the membrane (rotational, diffusion, flexion, flip- fl...

A: Lipid movements in the membrane is of different types depending on the purpose.

Q: 11: All of the following are features associated with the earliest members of the genus Homo (e.g., ...

A: Features associated with Homo habilis except-

Q: The Coulter counter works on the following principle: O A. the increasing current is indirectly prop...

A: Coulter Counter Principle: - It is based on the principle that electrical resistance of a conducting...

Q: Interferons are primarily produced in response to infection with which pathogen type? Group of answe...

A: Introduction :- Interferons are synthetic analogues of proteins produced by your body. These medic...

Q: Determine the Evolutionary Relationship of Human to Other Primates and Vertebrates using a Phylogene...

A: The pattern of branching in a phylogenetic tree reflects how species or other groups evolved from a ...

Q: Match the organic compounds with their corresponding examples. v sterol a. cysteine b. cholesterol C...

A: We are supposed to answer one question According to our guidelines. Please repost other questions se...

Q: Elaborate the relationship between vaccines and somatic hypermutation.

A: The immune system is a complicated physiological system comprised of several organs, tissues, and ce...

Q: What is Lamarck's Theory of Acquired Characteristics? Please give a brief explanation, thanks.

A: An acquired feature is something that has formed in the somatic or body cells of an individual over ...

Q: Monkeys and apes are odd when compared to other mammals because they lack the ability to produce vit...

A: L-ascorbic acid or Vitamin C , is a water-solvent nutrient that is normally present in certain food ...

Q: One of the features of the Acheulian stone tool industry is that the tools were made from stone that...

A: Acheulean (Acheulian) stone tool industry produced stone tools during the Lower paleolithic era acro...

Q: Which of the following is an antigen that would only be recognized by a specific antibody? Group of ...

A: Specific antibody Specific antibody is unique and designed to kill specific antigen.

Q: The placenta is formed from the embryo and the of the of the mother. O umbilical cord, oviduct O yol...

A: Reproduction is an important physiological process of all the living organisms. to increase their nu...

Q: Q113: Write a short answer for each question. • Expensive Tissue Hypothesis is an important concept ...

A: Evolution is a continuous transition of living forms, beginning with the basic forms of the past and...

Q: The theory of kin selection (inclusive fitness) takes into account that an organism can pass on copi...

A: Theory of kin selection states that an organism will favor the reproduction of close relatives over ...

Q: The Most Recent Common Ancestor (MRCA) is an individual who donated DNA to every single living perso...

A: Answer

Q: 1. A breeder performed a testcross to find out if his male dog was a purebred black. He got one brow...

A: 1. pure bred means homocide is dominant or it could mean header, homosexuals possessive, but in this...

Q: The part of the brain controlling basic body functions such as heart rate and blood pressure is the:...

A: The human body is composed of a number of organ system. All these systems perform the various import...

Q: Propose a strategy to prevent HIF-alpha signaling in the TME. What do you think would happen in a tr...

A: The oxygen-sensitive transcriptional activator HIF-1 (hypoxia-inducible factor-1) is an important tr...

Q: Ardipithecus differs from Australopithecus in which of the following ways? Group of answer choices A...

A: Humans descended from apelike predecessors through a long process of transformation known as human e...

Q: Design a flow chart to show how energy from the sun is transformed into energy for walking?

A: The food chain is a complex process of transformation of the energy of the sun to biochemical energy...

Q: Your patient has a three month history of weight loss, night sweats, and swollen lymph nodes. He has...

A: HIV predominantly attacks the CD4+ T lymphocyte cell, which is a part of the immune system. But, the...

Q: 1. COMPARE AND CONTRAST the GEL FILTRATION and ISOELCTRIC PRECIPITATION in terms of the principles g...

A: Compare and contrast the gel filtration and isoelectric precipitation in terms of the principles gov...

Q: In a resting neuron, there are more ions inside the cell and more ions outside the cell. sodium; pot...

A: Introduction :- The voltage across a cell membrane during the resting stage is known as the resting ...

Q: Patient A, who is a recipient of USA-based poly X8650-CA vaccine for its autoimmune allergic rhiniti...

A: Introduction Vaccine-associated hypersensitivity reactions are not infrequent; however, serious acut...

Q: Explain and list down the protocols in doing or preparation of materials for polymerase chain

A: Polymerase chain reaction is a type of DNA reproducing reaction which is usually required at the cri...

Q: How is blood typing for the ABO system and the Rh usually done?

A: Blood typing is the process of identification of blood type and Rh-factor identification. The blood ...

Q: In rabbits, the length of the tail is governed by 3 sets of additive genes A B and C. The longest ta...

Q: In a tabular form, compare the different biomes based on specific criteria. Follow the table format...

A: A biome is a defined area that is characterized by its flora, fauna, and climate.

Q: Protocols for analysing DNA

A: *DNA can be analysed through Polymerase chain reaction Short tandem repeat analysis Y chromosome a...

Q: make a dichotomous key of this creature the format should be like this: 1. a. The creature has a ...

A: Introduction: A dichotomous key allows the person to determine the identity of an organism in the na...

Q: How do plants and animals transport nutrients?

A: Plants and animals, both being living things, have an arrangement of physical structures that move v...

Q: Search the NCBI protein database using the EC number, limit your search to Mycobacterium tuberculosi...

A: We know about protein data base as we get the information of nucleic acid sequence or protein sequen...

Q: What are the possible effects of some ecological threats to the health of an ecosystem? Use the tab...

A: Ecological threat: The term describes the risks due to activities that may affect the environmnent. ...

Question

In Figure 9-17, what do you think happens next to the
ribosomal subunits after they are finished translating
that mRNA?

Termination of translation
UAA
E PA
5'
3'
RF1
RF1
AUA
A
Peptidyl--RNA
cleavage
RF1
FIGURE 9-17 Translation is terminated
when release factors recognize stop
codons in the A site of the ribosome.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
AGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3' UUUCCUCAA 5' code for? RNA Codon Chart 31 Alanine G U A Tyrosine Stop Valine A G Cysteine U 3' U G Stop G Tryptophan 3' G 5' Arginine G U A Leucine Serine A Lysine A U Proline G Asparagine leucine-threonine-glutamic acid asparagine-serine-phenylalanine serine-histidine-glutamine phenylalanine-proline-histidine phenylalanine-proline-glutamine Serine Glutamic acid Aspartic acid Histidine Glutamine Arginine Isoleucine 2 Threonine Methionine Q
The RNA components of ribosomes are synthesized in the.____ cytoplasm nucleus nucleolus endoplasmic reticulum
RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…
3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
What codon results in a release factor entering the ribosome? 5' M GPPP- CCGACGUAUAUGGCGACUGAUCACUGACCAACGA O UGA O AUG O ACG AAA AAAAAAAA - 3'
otein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. Submit
PPPP 2.7 essage hatentaded pruteiis? gene iS shown below (starting with ATG), What is the resulting mRNA? From which strand was this MRNA generated? 5'-ATGCCATTCGAA-3' 3'-TACGGTAAGCTT-5' 21. What is meant by degenerate but not ambiguous?
intron-Seauence of nueleotides klith in the gene but are r emeved fürm the Ŝeaçuente a final MKNA moleciles Is made. 31. How does an RNA molecule get modified (what part is kept and what molecules are used, what gets added on)? before
SARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/A
3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’ and 3’ directions appropriately on the mRNA, feel free to rewrite the DNA strand if needed to make it easier to interpret. Make sure to label the mRNA with a "5'cap" and place 10 A's to form the poly-A tail.
me e File Content 911 Edit verview....pdf X PDF view Histor Biol 140 X Doordena Content acconline.austincc.edu/ultra/courses/_891351_1/cl/outline X Begin: X O Tutorial X Match each term with its best description. You may use each answer choice more than once. location of transcription in prokaryotes RNA triplet on tRNA which pairs complementary to an mRNA codon to ensure correct amino acid is brought into the ribosome during translation 18 Unit 3 X location of translation in all cells process of rewriting DNA code into mRNA code mRNA triplets which code for a specific amino acid Unit 3 ( x process of converting an mRNA transcript into a seuence of amino acids making up a polypeptide folded RNA that carries amino acids and transfers them to the ribosome during translation makes up ribosomes along with proteins location of transcription in eukaryotes intermediate between DNA and protein interpreted as codons specifying certain amino acids Content Your disk is alme Save space by op A.…