*The enzyme glucose oxidase isolated from the mold Penicillium notatum catalyzes the oxidation of ß-D-glucose to D-glucono-5- lactose. This enzyme is highly specific for the ß anomer of In spite of this glucose and does not affect the a anomer. specificity, the reaction catalyzed by glucose oxidase is commonly used in a clinical assay for total blood glucose that is, for solutions consisting of a mixture of 3- and a-D- glucose. What are the circumstances required to make this possible? Aside from allowing the detection of smaller quan- tities of glucose, what advantage does glucose oxidase offer over non-enzymatic oxidizing agents like Tollens reagent?
Q: Compare and contrast the biosynthesis of oleic acid via the aerobic and anaerobic route.
A: Oleic acid: Oleic acid, whose lipid number is 18:1 cis-9, is categorised as a monounsaturated…
Q: A. STARCH TUBE A B C HYDROLYSIS OF CARBOHYDRATES Treatment HCI, heat H₂O, heat RT, H₂O Benedict's…
A: Starch is a polysaccharide and sucrose is a disaccharide. Starch is also known as plant storage…
Q: Inhibitors for this reverse transcriptase fall in two classes: nucleoside analog inhibitors (NRTIs)…
A: Reverse transcriptase is an enzyme that synthesizes DNA from RNA. Reverse transcriptase catalyzes…
Q: Triosephosphate isomerase catalyzes the conversion of glyceraldehyde 3-phosphate to dihydroxyacetone…
A: In a general reaction such as: aA + bB⇌ cC + dD At equilibrium, the concentration of reactants and…
Q: Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram. C)…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: 4. A tRNA has the anticodon sequence 3'-CAG-5'. What amino acid does it carry? Illustrate how the…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Explain the function(s) of each of the basal transcription factors (the TFII "alphabet soup")
A: Basal transcription factors are required for the initiation of the transcription or mRNA synthesis.…
Q: Identify the enzyme involved in this reaction from the Krebs cycle. COO CH₂ CH₂ Coo FAD O isocitrate…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Component 1 PCR buffer 2 MgCl2 3 dNTP mix 4 SSR forward primer 5 SSR reverse primer 6 Taq polymerase…
A: PCR is also known as a polymerase chain reaction which is generally used to amplify the template DNA…
Q: What is meant by intrinsic GTPase activity? Exchange of GDP for GTP on the a-subunit of the G…
A: GPCRs interact with G proteins in the plasma membrane. G proteins are specialized proteins that can…
Q: Identify the enzyme/protein involved in replication: multiple choice Addition of short RNA primers…
A: The DNA replication is the process of producing two identical copies of DNA from one original double…
Q: What is an example of RNA editing? Changing a valine codon to a stop codon Methylation of cytosine…
A: Nucleic acids like DNA and RNA can be edited in various ways. Editing is done for various reasons…
Q: Insulin deficiency (occurrence/factors) factors affecting insulin levels including biological,…
A: The hormone insulin is in charge of permitting blood glucose to enter cells, giving them the energy…
Q: Can you please Draw what this should look like. Chromosome Model Procedure for making a solid wire…
A: The thread-like structures are seen inside the nucleus. During cell division, the chromosome…
Q: explain what coupled transcription-translation is, and why it occurs in prokaryotes but not…
A: According to the central dogma of molecular biology, the process of gene expression involves two…
Q: Give the systematic name for the disaccharide shown in the image by selecting the appropriate terms.…
A: Conformation is the different positions a molecule can twist into. Configuration is the arrangement…
Q: Which factor does NOT represent a barrier that prevents a reaction from taking place? substrate…
A: Reaction is a process by which a set of molecules is transformed to another. Many factors effect the…
Q: The proton-motive force is a measure of the potential energy generated across the mitochondrial…
A: The electron transport chain (ETC) is a chain of electron carriers present in the inner…
Q: Exergonic and endergonic biochemical reactions; the role of ATP and other macroergic substances in…
A: INTRODUCTION : ATP - Adenosine triphosphate, it is the main energy currency or units, which is…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…
A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…
Q: How many reduced molecules (NADH, FADH2, NADPH) will be generated by converting lineoleic acid…
A: The fats are stored in eukaryotes as triglycerides that are broken down using the enzyme Lipase to…
Q: The following are coenzymes or cofactors involved in enzymatic reactions. Identify the biochemical…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes are…
Q: There are some cells in our bodies (stem cells) that are able to form new structures even in adults.…
A: Stem cells are undifferentiated cells In our body that can turn into any specific cells, as per the…
Q: Name 2 prominent secondary structure of protein,lable out 3 differences between them.
A: Proteins are the polymers of amino acids. They have four different levels of structural…
Q: A geneticist is trying to determine how many genes are found in a 300,000 bp region of DNA. Analysis…
A: The question mentions that the geneticist is trying to figure out the number of genes that could be…
Q: Fast please At 20 Celsius degree, protein-Z binds DNA with a free energy of –7 kJ/mole. Protein Z…
A: Free energy: Whether reactants and products will change spontaneously depends on the amount of free…
Q: Which of the following correctly matches the chromatography technique with the molecular property…
A: Chromatography is a laboratory technique for the separation of a the components that are present in…
Q: Given the following enzyme-catalyzed reaction, identify the class and subclass of the enzyme…
A: Enzymes are classified into six classes. They are oxidoreductases, transferases, hydrolases,…
Q: Will weighs 80 kg and his plasma osmolarity is 280 mOsm/L. He eats a salty snack containing 250 mM…
A: Plasma Osmolarity: The number of solute particles per 1 L of solvent is referred to as osmolarity.…
Q: Hair is comprised largely of keratin, a fibrous protein consisting of two a-helices wrapped around…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: 3. In the experiment shown below, researchers looked at the effects of glucose-free medium on…
A: Glutamate is an amino acid that is synthesized from glutamine and through the transamination of…
Q: How much energy is required to synthesize a saturated C12 fatty acid? How does this compare with the…
A: Fatty acid synthesis occurs in the cytosol of all eukaryotic cells except plants (occurs in…
Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…
A: AP sites are apuraniya sites that are created through the hydrolysis of N glycosyl bond between…
Q: Based on the amino acids present in the segments between the breakers, what do you predict the…
A: A protein's function depends on its structure. There are four levels of protein structure: primary,…
Q: The transition state of a reaction is O easily isolated using column chromatography. by definition…
A: The completion of a chemical reaction, from the substrate to the product involves the formation of…
Q: What is the role of ribose in Central Dogma of Molecular Biology?
A: The information stored in the DNA flows to RNA and is then used in the synthesis of proteins. This…
Q: If your body sense that is very low on the substrates necessary to produce ATP homeostatic control…
A: Deamination of amino acids - it is the process of breakdown of amino acids which occurs in excess…
Q: Which is most negative at a pH of 7 Tyr-Lys-Met Gly-Pro-Ara Asp-Trp-tvr V Asp-His-Glu Leu-Val-Phe…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: A 100 mL solution of 0.1 M amino acid (AA) at pH 1.0 was titrated with 1.0 M NaOH solution. The pH…
A: Amino Acids: All amino acids have an amine and a carboxylic acid functional group with acid/base…
Q: Refer to the chromatograph (Figure 1) below and answer the questions that follow: What is the…
A: Affinity chromatography is a separation technique that takes advantage of the ligand specificity…
Q: Which of the following activities are present in the endomembrane system organelles? I.…
A: Endomembrane system organelles are the connected and coordinated pathway of membrane bound…
Q: A first year BS Nursing was given an unknown carbohydrate that could be any of the following:…
A: Iodine test is a qualitative test for carbohydrates. In the iodine test, the polyiodide ions react…
Q: Explain why quaternary structure is necessary for cooperativity and allosteric regulation. Use…
A: The proteins with two or more polypeptides are called oligomeric proteins and possess a quaternary…
Q: One of the hallmarks of competitive inhibition is that there is constant competition between the…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. They contain an…
Q: Yeast cells are grown with galactose as the sole carbon source and ATP levels are abundant. Describe…
A: GAL genes: The GAL genes, which include structural (GAL1, GAL10, GAL2, and GAL7) and regulatory…
Q: QUESTION: For each enzyme identify the transition-state inhibitor analog by drawing a circle around…
A: Whenever a reaction takes place there are reactants and they form products but in between, during…
Q: Fill in this table for cortisol, aldosterone, testosterone, estradiol, parathyroid gland hormone,…
A: Hormones are chemical messenger or signaling molecules present in our body which travel in our…
Q: Define vmax. How is vmax related to kcat?
A: The rate of a reaction can be monitored by various parameters. These are Km, Vmax, Kcat etc. Each of…
Q: In the tertiary structure of a protein, glutamine can interact with O valine; hydrophobic…
A: Proteins are bio molecules with vast diversity in their structure. They exhibit four levels of…
Q: At a substrate concentration that is much greater than the Km for the reaction, which statement is…
A: An increase in the substrate concentration increases the reaction velocity. The reaction reaches…
Step by step
Solved in 3 steps
- a. Compounds A, B, C, and D are known to be intermediates in the pathway for production of protein E. To determine where the block in protein-E production occurred in each individual, the various intermediates were given to each individuals cel Is in culture. After a few weeks of growth with the intermediate, the cells were assayed for the production of protein E. The results for each individuals cells are given in the following table. A plus sign means that protein E was produced after the cells were given the intermediate listed at the top of the column. A minus sign means that the cells still could not produce protein E even after being exposed to the intermediate at the top of the column. Draw the pathway leading to the production of protein E.The enzyme glucose oxidase isolated from the mold Penicillium notatum catalyzes the oxidation of β-Dglucose to D-glucono-δ-lactone. This enzyme is highly specific for the β anomer of glucose and does not affect the α anomer. In spite of this specificity, the reaction catalyzed byglucose oxidase is commonly used in a clinical assay for total blood glucose—that is, for solutions consisting of a mixture of β- and α-D-glucose. What are the circumstances required to make this possible? Aside from allowing the detection of smaller quantities of glucose, what advantage does glucose oxidase offer over Fehling’s reagent for measuring blood glucose?The enzymatic activity of PFK1 is generally measured by set- ting up a coupled enzyme assay system whereby aldolase, triose phos- phate isomerase, and glycerol-3-phosphate dehydrogenase are added to the assay mixture. For the latter enzyme, NADH is added and its change in concentration is readily monitored at 340 nm. Write the chain of reactions catalyzed by these enzymes using structural formulas, label substrates and products, and explain why the coupled en- zyme assay system leads to oxidation of NADH. While the chain of reac- tions is similar to those in glycolysis, there is a critical difference because of the dehydrogenase enzyme. Describe how this enzyme causes the chain of reactions to differ from those in glycolysis.
- The specific activity of a pure preparation of pyruvate kinase (PK) assayed in the direction of pyruvate formation (forward direction) is 220 U/mg at 25 C and at pH 7.5. This form of PK is a homotetramer (MW 240,000) with one active site per subunit. What is the kcat for PK in the forward direction?The enzyme glucose oxidase isolated from the mold Penicillium notatum catalyzes the oxidation of B-D-glucose to D-glucono-6-lactone. The enzyme is highly specific for the B anomer of glucose and does not affect the a anomer. In spite of this specificity, the reaction catalyzed by glucose oxidase is commonly used in a clinical assay for total blood glucose -that is, for solutions consisting of a mixture of B- and a-D-glucose, as well as other sugars present in blood. The oxidation proceeds in the presence of oxygen and forms hydrogen peroxide, in addition to the lactone. A second enzyme, called peroxidase, catalyzes the reaction of hydrogen peroxide with colorless compounds to create a colored product, which is quantified with a simple spectrophotometer. What are the circumstances required to make this possible? Aside from allowing the detection of smaller quantities of glucose, what advantage does glucose oxidase offer over the Fehling's reagent for measuring blood glucose?Glucosidase I catalyzes hydrolysis of specific glucosidase I is a synthetic trisaccharide, glucose-al-2- glucose-al-3-glucose-a-O(CH₂) #COOCH3. Kinetic measurements oligosaccharides containing glucose. obtained using this trisaccharide as substrate in the deoxynorjirimycin at concentrations of 50 μM (), 100 μM absence (x-x) and presence of the inhibitor 1- A) were used to prepare the (-), and 200 μM (4 Lineweaver-Burk plot below: b) Page 3 12) 7. a) V/V (nmol/hr)-1 1.S 1.0- 0.5 1/Trisaccharide (mM)-! Estimate the values for Vmax and KM for the trisaccharide substrate in the absence of the inhibitor. 0.0 -1.0 0.0 One substrate for 1.0 2.0 Determine whether inhibition by 1-deoxynorjirimycin is competitive, non-competitive or neither.
- 3. (a) The activity of the Pentose Phosphate Pathway is commonly quantified by measuring 14CO2 production from C-14 labeled glucose. In this assay, glucose is metabolized aerobically by cells or tissue slices; both [1-14C] glucose and [6-14C] glucose are employed separately but in parallel. This classical method, thus, requires two separate assay mixtures. Which radioactive isotopomer of glu- cose releases 14 CO2 generated by the Pentose Phosphate Pathway? Confirm your conclusion by drawing the intermediates of the oxidative phase of the PPP with structural formulas, starting with glucose-6-phosphate. Name the intermediates and indicate enzymes. (b) ( Because the assay protocol requires aerobic incubation of cells or tis- sue slices with isotopically labeled glucose in parallel assays, what is the purpose of the other radioactive glucose derivative? To answer this question base your answer using the diagram on the right. O2 NADH CH₂OH + 2 NAD+ HO HO + 2 Pj 2 CO + 2 ATP HO OH 2 ADP CH3…Multivitamin B complex are essential compounds that are used as derivatives for compounds necessary for many metabolic activities. Give 3 vitamin B compounds and explain where and how they are used along the metabolic pathway.ALANINE AMINOTRANSFIRASE AND ASPARTATE AMINOTRANSFERASE (KARMEN МЕТHOD) (C. chemistry) 1. state the reason why substrate must be incubated prior to the addition of serum 2. what part of the steps need extra to avoid positive results? 3. describe the principle of AST/ALT kinetic method.
- 3. (a) The activity of the Pentose Phosphate Pathway is commonly quantified by measuring 14CO2 production from C-14 labeled glucose. In this assay, glucose is metabolized aerobically by cells or tissue slices; both [1-14C] glucose and [6-14C] glucose are employed separately but in parallel. This classical method, thus, requires two separate assay mixtures. Which radioactive isotopomer of glu- cose releases 14 CO2 generated by the Pentose Phosphate Pathway? Confirm your conclusion by drawing the intermediates of the oxidative phase of the PPP with structural formulas, starting with glucose-6-phosphate. Name the intermediates and indicate enzymes. (b) ( Because the assay protocol requires aerobic incubation of cells or tis- sue slices with isotopically labeled glucose in parallel assays, what is the purpose of the other radioactive glucose derivative? To answer this question base your answer using the diagram on the right. O + 2 NADH CH₂OH + 2 NAD+ ○ HO HO + 2 Pi 2 CO + 2 ATP HO OH 2 ADP…The activity of the enzyme β-galactosidase produced bywild-type cells grown in media supplemented with different carbon sources is measured. In relative units, thefollowing levels of activity are found:Glucose Lactose Lactose + glucose0 100 1Predict the relative levels of β-galactosidase activity incells grown under similar conditions when the cells arelacI−, lacIS, lacO+, and crp−.The mitochondrial form of carbamoyl phosphate synthetase is allosterically activated by N-acetylglutamate. Briefly describe a rationale for this effect.