The immediate product of this process is 3-phosphoglycerate. Light Reaction Calvin Cycle Both Light Reaction and Calvin Cycle Neither Light Reaction nor Calvin Cycle
Q: retort pouch is: a) Filled first with food product and then retorted (heat-sterilization) to extend…
A: In retort pouch food is filled into a pouch . Then it sealed and next heated to extremely high…
Q: Why do some scientists use immersion fluids when looking at their microscope slides? Increases the…
A: One of the problems in light microscopy is to overcome the limits of the optical resolution and…
Q: Using the table below, differentiate the effect of two varying pH levels (as indicated by by the…
A: Enzymes are affected by changes in pH. The most favorable pH value - the point where the enzyme is…
Q: Question 16 The fact that some eukaryotic FRNAS are self-splicing indicates that (A RNA can contain…
A: Nucleus is main controller of the cell which possess genetic information . It also contain long…
Q: Distinguish between positive and negative control. Give examples of each from the lac operon
A: Operator is a unit consisting of one or more cistrons that function coordinately under the control…
Q: Think of reasons why it is important to maintain the number and structure of chromosomes
A: Genes are passed from parent to child making each of us unique.Chromosomes are thread-like…
Q: Also answer Location number where correspond the 3 end of mRNA from this gene ans where u would find…
A: Exons are nucleic acid coding sequences that can be found in mRNA. Non-coding segments in DNA are…
Q: During activation, there is a secondary exchange of signals between the presenting cell & activated…
A: During activation , there is a secondary exchange of signal between presenting cell and…
Q: . Why is the relationship P=p2 used for homozygous loci?
A: Introduction :- Homozygous for a given locus refers to diploid and polyploid cells that have the…
Q: A hypothetical population was found to have a genotype frequency of AA=20%, Aa=40%, aa=40%. What…
A: Hardy-Weinberg provides the null hypothesis that links the alleles and the genotypes in the…
Q: what type of selection is this trait likely experiencing in this population?
A:
Q: GUIDE QUESTIONS: 1. Identify the fixation and embedding protocols of seed tissues for microtome…
A: Microscopes are extremely significant equipment that is mostly utilized in the field of science. The…
Q: What are the two important parts of Meromyosin protein?
A: Introduction - Myosin contains a component called meromyosin (mero meaning "part of"). Myosin and…
Q: Leo was taking angiotensin converting enzymes inhibitor or what is known as ACE inhibitor; this…
A: The renin–angiotensin–aldosterone system (RAAS) is a critical regulator of blood volume and systemic…
Q: How do Restriction Enzymes like EcoRI work?
A: Restriction endonucleases are the enzymes which is used to cut particular region of DNA . They make…
Q: You are working with a yeast that can undergo fermentation or respiration. You take equal aliquots…
A: Cellular respiration, like burning, results in the complete oxidation of glucose into CO2 and water.…
Q: Complete the table. Calculate the size of a theoretical population of E. Coli, if given unlimited…
A: The generation time of the given bacteria Escherichia coli is 20 minutes. This means that every 20…
Q: Climate change, water and politics are 3 of the 10 fundamental environmental issues. Select one: O…
A: Earth is currently facing a lot of environmental concerns. The environmental problems like global…
Q: Using a spider diagram or map, show the techniques, application and importance of recombinant DNA…
A: Introduction :- Recombinant DNA technology involves the development of Recombinant DNA (rDNA)…
Q: Explain the neutral theory of molecular evolution (20%) and how you use it as a null hypothesis to…
A: There are multiple evolutionary terms that helps in establishing a role in the molecular evolution.…
Q: Punctuated Equilibrium is a hypothesis that ... O suggests that evolution is not gradual but occurs…
A: Punctuated equilibrium is a hypothesis that evolution of a species is marked by sudden isolated…
Q: n prokaryotes, the sigma factor recognizes base sequences in the which facilitates RNA polymerase…
A: Sigma factors play a key role in the regulation of gene expression in response to changing…
Q: Explain how the activities of endocrine glands are regulated. 250 word count in own words thank you
A: Introduction :- The endocrine system is made up of hormone-producing glands. Hormones are the…
Q: Which of the following images shows a phage with a Siphoviridae morphotype? A) B) C)
A: Siphoviridae viruses are double stranded DNA viruses which belong to order Caudovirales. this family…
Q: Which of the following are true for the c-myc gene? Select all that apply
A: Myc is a group of regulator genes that code for transcription factors. c-myc is one of the genes in…
Q: A hypothetical population was found to have a genotype frequency of AA=20%, Aa=40%, aa=40%. If the…
A: The genotype of the population is a number of populations with the given genotype and is calculated…
Q: What cell receptor does adrenaline reach
A: Adrenaline or epinephrine is a hormone released by the medulla of the adrenal glands. It is released…
Q: Most inherited forms of cancer involve _______________ and these individuals are for the mutation.…
A: Firstly we can examine what each of the terms given represents. 1. Tumor suppressor gene: It is a…
Q: QUESTION 25 What is the value of identifying prevalent base changes found in different cancer types?…
A: Cancer is a fatal disease that has both physical and mental consequences for a person. Cancer can…
Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT: (A) MRE (в) GC Box c) GRE D…
A: Introduction Metallothionein is a protein that has a high affinity toward binding heavy metal ions,…
Q: economic and ecological significance of Rye (Secale)
A:
Q: Short Answer 4. You identify two recessive mutations in fruit flies, one that results in curly wings…
A: The chi square (x2) analysis is perform to compare the observed data with expected data. In…
Q: Which of the following is an environmental factor that leads to food insecurity? a) Poverty b)…
A: Food insecurity defines the conditions when there is an inadequate amount of food they consume (in…
Q: For the following sequence, transcribe and translate the sequence into a protein. Be sure to…
A: Given strand is DNA template strand- 3'-TACCACCCCCTGAGTGCTGGGATC-5' Transcription of template Strand…
Q: Which types of macromolecules (protein, carbohydrate, fat, or nucleic acid?) can be enzymatically…
A: Digestion is accomplished by mechanical and chemical processes. Enzymes aid in chemical digestion.…
Q: Ascaris lumbricoides, I.s. Illustrate the stages of mitosis, as seen under HPO. Label the stages…
A: Answer :: Cell division:- Cell division happens when a parent cell divides into two or more…
Q: Which of the following features is NOT helpful in determining the start site of a gene?…
A: Translation: The process through which RNA codes for specific proteins is known as translation. It…
Q: 1 Why is the bulk milk hauler an important link in assuring high-quality milk for humans? What…
A: Bull milk contain high amount of calcium and minerals. These are necessary for bone develpoment.…
Q: How can you tell someone’s social class? What indicators can be misleading?
A: A group of members present in a society divided on the basis of their social and economical status…
Q: Pathology for major depressions
A: Major Depressive Disorder is a mood disorder defined by symptoms of loss of motivation, decreased…
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: The inner lining of the vessel (intimate) from the inside extends the epithelium. Name it. O…
A: The inner lining of all the blood vessels like arteries, arterioles , veins , venules and…
Q: What does the color of Leo’s urine tell you about how concentrated or diluted it is? What about his…
A: 1.Before exercise leo is well hydrated because his urine color is pale yellow this is also supported…
Q: Mutating the gene Transformer (tra) in Drosophila that is chromosomally XX leads to the development…
A: A mutation is a change in an organism's DNA sequence. Mutations can occur as a result of mistakes in…
Q: What is corpus luteum. How does it function as an endocrine gland?.
A: Introduction :- During the ovulatory phase, when an ovarian follicle releases an egg, the opened…
Q: What is the main reason for archiving your phage? so that you could repeat the DNA isolation (for…
A: The answer is to store your phage long term so that anyone who accesses the phage database could…
Q: Describe the features of the fluid mosaic model of the cell membrane.
A: Cell membrane It is defined as the membrane that protects the cell from its environment by…
Q: You look a cell. The cell has n=5. You see five pairs of condensed sister chromosomes on each side…
A: Introduction - Mitosis and meiosis are two types of cell division. When people say "cell division,"…
Q: Create a conclusion about spermatogenesis by using the objectives below. To identify the…
A: Spermatogenesis is a long and precise cycle through which spermatozoa are delivered inside…
Q: Characterize the scope of indoor air pollution and assesssolutions
A: Air pollution is the addition of substances to the air that lowers its quality.
Step by step
Solved in 2 steps
- The Relative Efficiency of ATP Synthesis in Noncyclic versus Cyclic Photophosphorylation If noncyclic photosynthetic electron transport leads to the translocation of 7 H+/2e- and cyclic photosynthetic electron transport leads to the translocation of 2 H+/e-, what is the relative photosynthetic efficiency of ATP synthesis (expressed as the number of photons absorbed per ATP synthesized) for noncyclic versus cyclic photophosphorylation? (Assume that the CF1CF0-ATP synthase yields 3 ATP/14 H+.)Which of the following pathways requires molecular oxygen (O2)? a. aerobic respiration b. lactate formation c. alcoholic fermentation d. photosynthesisWhich of the following substances does not participate in the Calvin-Benson cycle? a. ATP c. NADPH e. PGAL b. O2 d. RuBP f. CO2
- Eayside Foe Pe SSchoology S Schoology Eayside Fome Page Sudert Eoolrarks The Calvin Cycle is part of O Glycolysis O Krebs Cycle O Electron Transport Chain Light Independent ReactionsCalvin Cycle vs Kleb CycleAURESCO P Carbaxylase 3 CO2 1. Carbon dioxuide 60 reduced RUBP 3-phosphogh CALVIN CYCLE 2.3.Phospho- Shycerate is reduced to G3P 3 ADP 3 RUBP Is regenerated trom G3P 3 ATP 5 G3P G3P 16SP Glucose (six carbons) Co, is needed in theCalvin Cycle in order to Donate a carbon to the reaction break down ATP transfer chemical energy go back to the light-dependent reaction
- Phase 2 (Diagram 9) Description: Phase 3 (Diagram 10) Description: Why is the series of reactions in the Calvin cycle called a "cycle"? Diagram 9 CALVIN CYCLE: Phase 2- Reduction Diagram 10 B CO. $53 Phasdi Plase 2 CALVIN CYCLE: Phase 3 - Regeneration x6 x6 6 NADPH ALPUN 6 WADP + 6H1 Other organic molecules -BADP-IM Sthe wounic moleculesavelengths (Choose J |Choose | graph plotting a pigment's light absorption versus wavelength reaction- center complex is system consists of a reaction-center complex surrounded by nt-harvesting complexes absorption spectrum spectrophotometer molecule located in the reaction center accepts excited ctrons photosystem light harvesting complex reaction-center chlorophyll a of this photosystem iş called P680 ause it is best at absorbing a wavelength of 680 nm. primary electron acceptor wavelength PSI estion 4 PS II action spectrum >The diagram below shows the thylakoid membrane. Give reasons why you think the structure you see is PSI, PSII, cytochrome, or ATP synthase. STROMA Thylakoid membrane Lumen CP43 2H₂O D2 Cyt Osse Pheo Tyrz Mn Peao Mn D1 Mn Mn CP47 MSP O₂ + 4H*
- Photosyntheis equation 6CO2 Carbon dioxide 6H20 Light C6H1206 , 602 Sugar Water Oxygen Aerobic cellular respiration Chemical Equation - Aerobic Respiration CH1206 + 6 O2→ 6 CO2 + 6 H;O + 36 ATP Anaerobic respiration Lactic Acid Fermentation C,HO 20C H¸O, + 2 ATP Alcohol Fermentation C,H,0 2C,H,OH + 2CO, + 2 ATP What chemical reaction happens in your body that causes you to breathe out carbon dioxide? Explain your answer by talking about the inputs and outputs of the chemical reaction. (Level 3) étv MacBook Air 80 DII DD F3 F4 FS F7 F8 F9 F10 FV # $ % & 3 4 9. 7 8 E R Y U F G H. J K L C V M B トPhotosyntheis equation 6H20 Light C6H1206 , 602 Охудen 6CO2 Carbon dioxide Water Sugar Aerobic cellular respiration Chemical Equation - Aerobic Respiration CH1206 + 6 O2→ 6 CO2 + 6 H2O + 36 ATP Anaerobic respiration Lactic Acid Fermentation CH,20 2C,H,O, + 2 ATP Alcohol Fermentation C,H,,0 2C,H,OH + 2CO, + 2 ATP What chemical reaction happens in your body that causes you to breathe out carbon dioxide? Explain your answer by talking about the inputs and outputs of the chemical reaction. (Level 3) + tv MacBook Air DII DD 80 F8 F9 F10 F4 F5 F6 F7 F3 #3 2$ & 3 4 9. 7 Y F H J * 00 トWhat process is shown in the figure below? 3 Molecules CO2 RuBisCO Stage 1: carbon fixation 3 ADP 6 ATP ЗАТР 6 ADP Stage 3: regeneration of RUBP Stage 2: reduction 6 NADPH - 6 NADP*+ H* Sugar O Glycolysis O Light reactions of photosynthesis Oxidative phosphorylation Citric Acid Cycle O Dark reactions of photosynthesis