The sequence shown below is the 5' to 3' strand of a dsDNA template. What are the sequences of the two 18'mer oligonucleotides that you would need as primers for amplifying the underlined region? (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence). 5'-AATCCGACCTGATTCTAAAGCGCGCTAAGAGCTACGTAGGCACCCAT GTTGGAAATCTCTTATCGGAGATTTCTTCTTGATTACTGGCCCTATGCATI GTCATTCCATGCCATCGGTATTCTCGATACTTGTACTTGATGCATTCGA-3' Primer 1: 5'- Primer 2: 5'

The sequence shown below is the 5' to 3' strand of a dsDNA template. What are the sequences of the two 18'mer oligonucleotides that you would need as primers for amplifying the underlined region? (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence). 5'-AATCCGACCTGATTCTAAAGCGCGCTAAGAGCTACGTAGGCACCCAT GTTGGAAATCTCTTATCGGAGATTTCTTCTTGATTACTGGCCCTATGCATI GTCATTCCATGCCATCGGTATTCTCGATACTTGTACTTGATGCATTCGA-3' Primer 1: 5'- Primer 2: 5'

Name: Question 2: - selecting PCR primersThe sequence shown below is the 5'
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Question 2: - selecting PCR primersThe sequence shown below is the 5' to 3' strand of a dsDNA template. Whatare the sequences of the two 18'mer oligonucleotides that you would need asprimers for amplifying the underlined region? (Select the binding

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 10P: Homologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli...

See similar textbooks

Similar questions

Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. 1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?
5'-[seq]-3' The diagram shows the results of gel electrophoresis for Sanger sequencing. The wells are represented by open boxes and the DNA bands are represented by black boxes. The wells are labeled to show which dideoxy reaction was loaded into each. Write the sequence of the original template strand used for this sequencing reaction, with the 5’ end on the left and the 3’ end on the right.
For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’
6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and underlined. (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence.) 5-CAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGTG АTGTGGTGGСТАТTGATTAТАААСАСТАСАСАСССТСТТTTAAGAAAGGAGCTAAATTGTTACATAAACС-3' What is the 5' to 3' sequence of the reverse primer? O 5-TTC GTC CAA AGA ATA TTC-3' O 5'-CAA TAT TCT TTG GẠC GAA-3' TER O 5-GTT AAA TCG AGG AAA GAA-3' O 5-GTT ATA AGA AAC CTG CTT-3 5'-CAA TTT AGC TCC TTT CTT-3' Assessment Navigator Submit Questionmark Ondemand licensed to University of Dundee 41 MAR étv 30 MacBook Air DII 20 000 F9 esc F7 F8 F5 F6 F1 F2 F3 F4 2$ & ! 7 8. < co 土

6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and underlined. (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence.) 5'-CAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGG TG ATGTGGTGGCTATTGATTATAAACACTACÃCACCCTCTTTTAAGAAAGGAGC TAAATTGTTACATAAACC-3' What is the 5' to 3' sequence of the reverse primer? O 5-TTC GTC CAA AGA ATA TTC-3' O 5-CAA TAT TCT TTG GAC GAA-3' 5'-GTT AAA TCG AGG AAA GAA-3' O 5-GTT ATA AGA AAC CTG CTT-3 O 5'-CAA TTT AGC TCC TTT CTT-3'
Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’
There are numerous methods for sequencing DNA, including classical Sanger sequencing, automated Sanger sequencing, and next-generation sequencing technologies, including Illumina technology. Match the modified cytidine nucleotide triphosphates (NTPs) with DNA sequencing methods that utilize them. Classical Sanger sequencing HO-P=O O HO-P=O O HO-P=O O Automated Sanger sequencing -NH₂ CH3 H₂CN ° ? ?N HOOOO OH OH OH NH CH₂ Next-generation DNA sequencing (Illumina) CH₂ NH₂ Answer Bank
5) The restriction enzyme EcoRI recognizes the DNA sequence GAATTC and makes a staggered cut as shown in the blue figure below: GA ATTC CTTAAG If EcoRI cuts the generic fragment shown below, 2 fragments with "sticky ends" (single-stranded DNA) will result. "XXX.." denotes any combination of nucleotides that flank either side of the sequence. 6 base pairs 8bp's 5-СTGTAGAATІCGTTACGA- 3' 3-GACATCTTAAGCAATGCT- 5 CTGTAG EcoRI Digest AATTCGTTACGA GCAATGCT GACATCTTAA A. Given the sequence in the section of DNA shown below, draw boxes around the fragments that will be formed when cutting this region of DNA with EcoRI and HAEIII at the same time. 5'- GTGGCCATTCTAGCGCCGAATTCGGCAATTACGATCGTAGGCCATCGATGTAATTC -3' 3'- CACCGGTAAGATCGCGGCTTAAGCCGTTAATGCTAGCATCCGGTAGCTACATTAAG -5' B. Give the sizes in base pairs of each of the fragments that will be formed after making the cuts with these 2 enzymes (don't count the nucleotides in the single-stranded parts).
Restriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864
12:49 0 14. You want to amplify the DNA between two stretches of sequence shown in the figure below. Explain which one of the following primer pairs would allow you to amplify the DNA by PCR. DNA to be amplified 5'-GACCTGTGGAAGC -CATACGGGATTGA-3" 3'-CTGGACACCTTCG GTATGCCCTAACT-5" primers (1) 5'-GACCTGTCCAAGC-3 (2) 5-CTGGACACCTTCG-3 (5) 5-CATACGGGATTGA-3" (6) 5°-GTATGСССТААСТ-3° (3) 5'-CGAAGGTGTCCAG-3' (7) 5'-TGTTAGGGCATAC-3" (4) 5'-GCTTССАСАGGTC-3° (8) 5'-TCAATCCCGTATG-3' END 5 THE END
1a) When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?
Homologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli leads to the formation of regions of heteroduplex DNA. By definition, such regions contain mismatched bases. Why doesnâ€™t the mismatch repair system of E. coli eliminate these mismatches?