This is a homework question that I have on my Adv. Anatomy & Physiology assignment. How to I got about answering the question? (I do have the Codon table in my textbook) Consider a hypothetical protein that consists of the amino acid sequence arginine, phenylalanine and histidine. From this information, construct (1) the original DNA strand, (2) corresponding mRNA codons and (3) tRNA anticodons used to produce this hypothetical protein. (Only use 1 mRNA codon per amino acid.) In addition, be sure to include start and stop sequences where appropriate.

This is a homework question that I have on my Adv. Anatomy & Physiology assignment. How to I got about answering the question? (I do have the Codon table in my textbook) Consider a hypothetical protein that consists of the amino acid sequence arginine, phenylalanine and histidine. From this information, construct (1) the original DNA strand, (2) corresponding mRNA codons and (3) tRNA anticodons used to produce this hypothetical protein. (Only use 1 mRNA codon per amino acid.) In addition, be sure to include start and stop sequences where appropriate.

Name: This is a homework question that I have on my Adv. Anatomy & Physiolog
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: This is a homework question that I have on my Adv. Anatomy & Physiology assignment. How to I got about answering the question? (I do have the Codon table in my textbook)Consider a hypothetical protein that consists of the amino acid sequence arginine

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 2FIO

See similar textbooks

Similar questions

Pissssssssss helppppppppp, One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic cell using the nitrogen bases of the given DNA strand. Include the following terms in your description (1 paragraph pls): -DNA - mRNA -protein -tRNA -Amino acid -codon -nucleus -Ribosome -cytoplasm -transcription -translation
The queation on my assignment is select the description of an exon? the answers they give are: 1. sequence of adenine nucleotides added onto the end of pre‑mRNA 2. modified form of a guanine nucleotide added onto the end of pre‑mRNA 3. coding portion of a DNA sequence that is present in mature mRNA 4. noncoding portion of a DNA sequence that is removed from pre‑mRNA then it wants you to explain your reasoning for your answer that you picked
Plssssssssss helppppppppp, One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic cell using the nitrogen bases of the given DNA strand. Include the following terms in your description: -DNA - mRNA -protein -tRNA -Amino acid -codon -nucleus -Ribosome -cytoplasm -transcription -translation
Concept Overview: Protein Synthesis Task 2: Review the process of protein synthesis by placing the cards in their appropriate category. Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge check. Transcription Translation No Answers Chosen No Answers Chosen Transcription & Translation Neither No Answers Chosen No Answers Chosen Possible answers DNA is copied into MRNA Involves tRNA | Occurs in the mitochondria Information in MRNA is used to produce a protein Occurs in the nucleus Involves mRNA Utilizes ribosomes Involves DNA polymerase Involves RNA polymerase Occurs in the cytoplasm :::: :::: ::::
Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…
Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)
Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________
Match the concepts with their definitions or examples. Match each item to a choice: DNA gyrase histones nucleosome hydrogen bonding serine ribose,2-deoxyribose N-terminal to C-terminal TRNA synthetase cysteine 5' to 3' Choices: : amino acid coded by UCG : direction of DNA synthesis ! enzyme that attaches amino acid to tRNA : direction of protein synthesis : amino acid coded by UGC : chemical bond that holds the double stranded DNA together i protein associated with DNA during supercoiling # structure formed when a DNA strand winds itself around basic protein : relieves the strain brought by DNA supercoiling : compound that serves as the basis of the 5' and 3' designation
Explain why DNA replication must be primed by RNA. Explain how splicing happens in 4-5 sentences. Splicing is caused by a complex called spliceosome. This complex removes introns and joins the exons. It is called post transcriptional processing of RNA. (What I have so far) If you can only answer the first question, that is fine! Thank you for your help!
Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation • Which position shows the "A" position? right side (no tRNA) • Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the 5' end of the anticodon? the C U! UCUGCUACUAGUAACACGU
Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation • Which position shows the "A" position? right side (no tRNA) • Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the 5' end of the anticodon? the C CUAGAC UAGAUCUGCUACUAGUAACACĞU
Locate as accurately as possible the listed items that are shown on the following figure. Some items are not shown. (a) 5′ end of DNA template strand; (b) 3′ end of mRNA; (c) ribosome; (d) promoter; (e) codon; (f) an amino acid; (g) DNA polymerase; (h) 5′ UTR; (i) centromere; (j) intron; (k) anticodon; (l) N terminus; (m) 5′ end of charged tRNA; (n) RNA polymerase; (o) 3′ end of uncharged tRNA; (p) a nucleotide; (q) mRNA cap; (r) peptide bond; (s) P site; (t) aminoacyl-tRNA synthetase; (u) hydrogen bond; (v) exon; (w) 5′ AUG 3′; (x) potential wobble interaction.