This model represents protein synthesis since the TRNA is delivering amino acids to form a polypeptide chain that will form a protein. This model represents protein synthesis since the tRNA is delivering lipids which will be used to bond proteins to form an enzyme. This model represents protein synthesis because DNA is being copied during transcription in the nucleus before leaving the nucleus. This model represents protein synthesis because mRNA is coiling to form a new protein molecule in the cytoplasm.

Q: e? A)A gene's promoter sequence is transcribed into mRNA. B)Translation begins at the 5′ end of a…

A: Transcription is the process of formation of mRNA from the DNA.and Translation is the process of…

Q: Below is a list of functions related to protein synthesis. Place the number for the function in the…

A: The production of RNA from the DNA is known as the transcription process that occurs within the…

Q: If a tRNA molecule has an anticodon which reads AUG what was the codon of the mRNA MOLECULE

A: tRNA is also called a transfer RNA. It is a secondary structure of RNA having stem loops. It is a…

Q: What regulates the process of transcription and translation; compare and contrast these processes.

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA

A: Translation is the process by which proteins are synthesized by joining of amino acid using mRNA and…

Q: Which is a feature of mRNA processing in eukaryotes? removal of exon sequences addition of a…

A: Processing of mRNA Until introns are removed and the mRNA is considered ready for translation,…

Q: mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: Use your DNA strand to construct a part of a messenger RNA molecule.            DNA            A G T…

A: When DNA is converted into mRNA then this process is called transcription.Transcription occurs in…

Q: A mutation takes place during replication and the new DNA strand has the sequence 3'-ATG-5' What is…

A: The genetic code is a triplet code called a codon. The indicated amino acid can be specified by more…

Q: During translation, small organelles called ____ read the mRNA sequence. These organelles direct…

A: Protein synthesis is a complex process and requires sequential steps of transcription and…

Q: Which best describes the storage of the genetic code? A gene is a segment of DNA, a condensed DNA…

A: Introduction: The mRNA that is present in the cell gets decoded when its nucleotides are read in a…

Q: Explain how a single base change in a gene could lead to premature termination translation of mRNA…

A: Premature termination of translation refers to the termination of protein synthesis before the…

Q: The direction of MRNA molecule synthesis is . Select one: O a. From DNA strand that starts with 5' O…

A: BASIC INFORMATION TRANSCRIPTION  It is the process in which the genetic information present on one…

Q: Which description best fits the definition of a messenger RNA? a An RNA that encodes for a protein b…

A: RNA is a single-stranded nucleic acid that aids in protein synthesis in our bodies.

Q: Human genetic material is represented in the diagram below. A The region labeled A is made up of a…

A: Genes include the bases that are used to assemble protein and RNA. The human genome has a wide…

Q: Match each statement below with the correct RNA molecule.   A. rRNA B. mRNA C. tRNA D. uRNA…

A: mRNA contains the codons in the form of triplet of nucleotides during transcription and is…

Q: Some RNAs Involved in Gene Expression   Brings the appropriate amino acids to the ribosome. Brings…

A: Introduction : The DNA or deoxy ribonucleic acid is the genetic material present in most of the…

Q: mRNA binds to a ribosome. Transcription completes. mRNA leaves the nucleus. tRNA attaches to the…

A: DNA translation is the term used to portray the course of protein synthesis by ribosomes in the…

Q: In protein synthesis, DNA transcription records the genetic message, while ribosomal ______________…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: Observe the DNA strand (see pictures).  The following table shows this same DNA strand, a short…

A: The DNA (deoxyribonucleic acid) is the double-stranded molecule which is the genetic material in…

Q: Below is a list of functions related to protein synthesis. Place the number for the function in the…

A: The process of  copying information from the DNA molecules into the molecule of RNA is called…

Q: Treating a cell with a drug to stop tRNA from doing its job would mean what? A. that ribosomes…

A: Introduction Translation is the process through which a cell uses the genetic information conveyed…

Q: Use the codon table shown above to help answer this question. What protein sequence would a cell…

A: The mRNA sequence is: 5' CCAUGCACCAAUAGAUAACCG 3' The Codon is read in triplet form.

Q: Explain the process of mRNA to DNA translation

A: The second phase of protein production is translation. It happens after transcription when DNA…

Q: Which of the following statement about RNA is FALSE? rRNA is critical for protein synthesis as it is…

A: Ribonucleic acid (RNA) is a nucleic acid which has similar features to DNA and is found in all…

Q: _____________ are molecular machines that excise introns from pre-mRNA and then join exons together.

A: In eukaryotes, the RNA transcript that is formed by transcribing a DNA molecule is termed pre-mRNA…

Q: Think about replication and transcription in a biological cell. Which process would involve…

A: Transcription is the process of DNA dependent RNA synthesis. It is carried out by the RNA polymerase…

Q: ______ molecules deliver amino acids to the site of protein synthesis. a. DNA b. mRNA c. rRNA d.…

A: The process of translation occurs in which proteins are synthesized with the incorporation of amino…

Q: Which process best describes the process of transcription? DNA strands open and both strands are…

A: 1. The process that best describes the process of transcription is: DNA strands open and one strand…

Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…

A: In the cytoplasm or endoplasmic reticulum, the process in which ribosomes synthesize proteins after…

Q: RNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides…

A: Deoxyribonucleic acid (DNA) comprises the genetic information or the instructions required by an…

Q: During transcription, ___________________. a. A cell divides to make 2 new cells b. A cell divides…

A: Transcription small explanation is provided in the below step.

Q: Write the sequence of bases in the sense strand of DNA that would result in formation of that…

A: DNA is converted to RNA by the process of transcription by an enzyme known as RNA polymerase. The…

Q: Messenger RNA ____________________. a. Carries amino acids to the ribosome b. Carries information…

A: DNA is converted into mRNA, this process is known as transcription. mRNA is converted into protein,…

Q: A biologist inserted a gene from a human liver cell into the DNA of a bacterium. The bacterium then…

A: It is majorly present within the nucleus. DNA can exist in different levels of complexity. Primary…

Q: Choose the combination of answers that most accurately completes the statement. Which of these…

A: The largest and broadest category of all groups in the classification of life is known as domain. At…

Q: Which form of RNA acts as a blueprint for protein synthesis in the ribosome? a. tRNA O b. rRNA O c.…

A: Introduction Proteins are complex biomolecules and macromolecules that are made up of one or more…

Q: Place the steps needed to create a protein in a human cell in order. Place the initial step at the…

A: The gene expression involve transcription and translation that are ultimately responsible for the…

Q: In protein synthesis, DNA transcription records the genetic message, while ribosomal ______________…

A: DNA is not directly involved in the expression of traits thus it acts as a master copy of genetic…

Q: The information in DNA is used by cells to produce proteins that perform various functions in cells.…

A: Transcription is the formation of a sequence of RNA using DNA as a template and DNA dependent RNA…

Q: Which statement correctly describes a codon? a sequence of three nucleotides that may code for one…

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: Use the model to answer the following questions. 1. Which of the arrows (1 or 2) represents…

A: Transcription is the process of formation of mRNA on DNA template catalyzed by RNA polymerase.…

Q: After RNA polymerase binds to DNA, it begins making mRNA. What is the name of this process?

A: According to the central dogma, the most common arrangement of information in our cells is: Making…

Q: During translation, __________________. a. A cell divides to make 2 new cells b. A cell divides to…

A: Cell is the basic structural and functional unit of life.

Q: The molecule is responsible for bringing the code from DNA to the ribosome during protein synthesis.

A: Ans. The messenger RNA (mRNA), in molecular biology, is a single-stranded RNA molecule that matches…

Q: The code on a DNA strand reads G C G T A A T G A. The mRNA strand would read:

A: Given: The code on a DNA strand reads GCGTAATGA.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.