Q: which bones are most used for assessing sex in an unknown individual? pelvis humerus…
A: The correct option is: pelvis Due to sexual size and shape dimorphism, the pelvis serves as the most…
Q: The process by which haploid cells are produced from diploid cells is called A( sexual reproduction.…
A: The DNA handed down from parents to children leads them to look alike. Reproduction necessitates DNA…
Q: Which of the followings statements are true about DNA polymerase? 1.) It can only go in one…
A: DNA polymerase is an enzyme that plays a key role in the replication of DNA. It catalyzes the…
Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…
A: Introduction The process by which a gene's information is used to produce either RNA molecules that…
Q: Next you examine all the bones for their epiphyses. You note that all epiphyses are fused with the…
A: The skeleton system of the human body consists of 206 bones. Bones are made up of connective tissue…
Q: Cancer cells need more DNA synthesis but the NADPH/ NADP* ratio is high. Which of the following…
A: Cancer cells are abnormal cells that divide uncontrollably and have the ability to invade other…
Q: Question: Which statement is TRUE about the phylogenetic tree below? 74 79 0.020 79 100 -Sardinella…
A: As we can see, S. fimbriata and S. albella are derived from same branch point (96), therefore they…
Q: 20. How many unique gametes could be produced through independent assortment by an individual with…
A: Answer is B ..8 Here from the genotype data Aa, Bb, Dd are heterozygous and CC, EE are homozygous.…
Q: The genetic defect responsible for abnormalities in individuals with Turner syndrome is? The…
A: The most prevalent sex chromosomal defect in females is Turner syndrome, commonly known as…
Q: Describe what occurs when a person experiences a chickenpox infection, including the cause, the…
A: Please follow steps 2 & 3 for detailed explanation.
Q: 6. Explain why a positive test for COVID19 would appear sooner than a negative result when using…
A: While studying the global pandemic it is assumed that approximately 300,000 children or more might…
Q: Shown are the counts of genotypes at two unlinked loci in a sample of 100 individuals from a…
A: The union of two creatures without the influence of social, environmental, or hereditary factors. A…
Q: he next several questions refer to the data given in this problem. You sample a population of…
A: Hardy-Weinberg equilibrium is a principle in population genetics that states the frequencies of…
Q: 4. The organism circled at the base of a phylogenetic tree is A نام B C the simplest organisms among…
A: Introduction - Phylogeny - is the evolution of a genetically related group of organisms. a study of…
Q: Briefly describe two important functions of the 5’ methyl guanine cap on eukaryotic mRNAs.
A: In eukaryotes, the nascent RNA that is synthesized by RNA polymerase II is called hnRNA…
Q: Antigens are made up of specific sequences of amino acids called ----- that determine their…
A: The defense mechanism of the body that protects the body from invasion of foreign pathogens is…
Q: Question: Based on the phylogram below, which taxon is closely related to domain Eukaryota? ARCHEA…
A: Increasing amounts of evidence point to a closer relationship between Domain Archaea and Domain…
Q: Indicate the number of nucleotide differences between the virus from Washington and the viruses from…
A: DNA and RNA are called as nucleic acids. The basic difference in the nucleotide sequence of DNA and…
Q: AL Ataisns AT Aborigins KU KO Kom KU Kurts MA Maral MO Mongols NO No Cent NU NEB AM Amerinds BU…
A: A human mitochondrial DNA (mtDNA) haplogroup is called haplogroup H. Around 20,000 to 25,000 years…
Q: Please explain whether CAR T-cells alter tumor cells expressing gasdermin -B, -E and -D when anti-…
A: Gasdermin is protein in humans, implicated in human response. It comprises six types in human, that…
Q: STRETCH BAND LATERAL RAISES Bones Muscles Joint type(s) Movement(s) Name an activity you could do in…
A: Your breathing and heart rate will increase during endurance or aerobic exercises. They enhance your…
Q: 3. Now consider the following diagram, where two replication bubbles are about to meet. 5 3 Draw in…
A: The lagging strand is the one that starts to open in the 3' to 5' direction toward the replication…
Q: Ilog PasigLahin is one of the non-government organizations (NGO) concerned with environmental…
A: The difficulty is that the river is rather short, and the drainage region is highly inhabited. It…
Q: Which species below is iteroparous? O A species in which individuals reproduce just one time, and…
A: Iteroparous species include humans (Homo sapiens), who are biologically able to produce several…
Q: What is the frictional loss of fitting for insulin pumps? And what is the potential energy…
A: Insulin pump: It is a device that is used for regulating the blood sugar and insulin levels in…
Q: Match the factor on the left with what it promotes on the right Mitogen Morphogen Death ligand…
A:
Q: What hormones are involved in renal functions, and what 2 systems, ultimately what affects water…
A: The kidneys assist in maintaining the body's fluid balance by filtering the blood. Small tubules in…
Q: You are tested for COVID. You have a positive antigen test, a positive RT-PCR test, and a negative…
A: Our bodies take some time to mount an immune response against an infectious agent. Therefore, it is…
Q: Please match the appropriate attributes for the two hormones provided (Estrogen and ADH) Hormone…
A:
Q: The Amoeba, the paramecium, and the euglena ( These are unicellular Protozoans) produce electrical…
A: Protozoans are unicellular eukaryotes belonging to the kingdom protista. The structure of…
Q: The simple act of covering the nose and mouth with a tissue when coughing or sneezing is an…
A: Introduction: Our reflexive ability to cough serves to shield our lungs and airways from irritants.…
Q: Steps to becoming human identify and describe each step and the are looking for in the fossil…
A: Anthropology is the study of human behaviour and societies in the past and present. It includes…
Q: Procedure 1. 2. 3. 4. 5. 6. Fill in the data table below. Complete column B by writing the correct…
A: Process of synthesis of RNA from DNA is known as transcription. As the colum A in the table…
Q: What color is the alpha gene spot on the microarray? Answer: Yellow please explain why is the…
A: The microarray can be described as a lab-on-a-chip. It can be used to detect the expression of…
Q: ad this story and identify the different aspects of the scientific method by choosing the Cement…
A: In order to prove something scientifically one conducts experiment on the basis of the observations.…
Q: Which of the following is NOT necessary for speciation to take place? Genetic divergence Physical…
A: Speciation is the evolutionary process by which a new species arises from an existing one. It…
Q: Are cells grown in the laboratory will function similarly when transplanted?
A: Transplanting laboratory-grown cells into the body causes them to behave similarly. For instance,…
Q: Briefly describe how the transcript beginning at the lambda PRe promoter can inhibit expression of…
A: The Cro protein is an effective and specific repressor of the RNA synthesis from the N and the cro…
Q: TRANSLATION
A: Central dogma: This theory states that the DNA contains instructions for making a protein which are…
Q: Central African chimpanzees (Pan troglodytes troglodytes) and bonobos (Pan paniscus) are two…
A: The events that are responsible for the evolution of species from the ancestral population is called…
Q: You are a technician working in a microbiology lab. You grow two bacteria cultures, Bug A and Bug B,…
A: The cell culture medium is a liquid nutrient solution used to grow and maintain cells in vitro. It…
Q: 4. Explain the connection between hepatitis D and B. How these diseases are related.
A: Hepatitis caused by a viral infection damages and inflames the liver. Hepatitis is brought on by a…
Q: 3. Using a reference, find the function of hyaline cartilage tissue in humans and one loca- tion…
A: Bones and joints are shielded by cartilage, a tough, flexible connective tissue. It serves as a…
Q: The volume of E. coli added to each warm agar pour/virus mixture was originally100µL. After…
A: E.coli when added to the agar pour containing virus was originally 100 ul and later changed to 300…
Q: WHEN do you think apoptosis occurs in humans? - What would be the effect if apoptosis doesn't…
A: ANSWER) Apoptosis is described as the natural programmed cell death occuring in the multicellular…
Q: State and recognize the three basic nutritional needs an organism’s diet must satisfy. List the…
A: Food consists of nutrients. Nutrients is categorised into seven major groups carbohydrates,…
Q: describe the IR spectra pattern of ascorbic acid (Vitamin C)
A: Analysing Infra Red (IR) spectra of any compound provide an idea about their identification through…
Q: Extranuclear inheritance can involve genes that are present in: ribosomes mitochondria…
A: Extra nuclear inheritance is also known as cytoplasmic inheritance. Extra nuclear inheritance is…
Q: If one nondisjunction event occurred during meiosis II, you would expect the four resulting gametes…
A:
Q: Example Problem: FRAP Data Interpretation The diffusion rate of four different membrane proteins (A,…
A: Please follow step 2 for detailed explanation.
Use the Chain of Infection to describe Legionnaire’s disease
Step by step
Solved in 2 steps
- Identify the mode of transmission in each of the following cases. Use the choices below question 31. 29- A child with mild diarrhea wipes himself after a bowel movement. He does not wash his hands afterwards. He and his mother share a bowl of chips. She has diarrhea a few days later. 30-A mosquito bites a blue jay (type of bird), and later bites a woman who is gardening in her yard. The woman gets West Nile Virus as a consequence of the mosquito bite. 31-A medical assistant, Mike, tidies up the room of a patient with C. difficile. He puts drinking cups and the TV remote off to the side. Mike uses some hand sanitizer on his hands, then goes to his next patient and does the same type of jobs. As a result, the second patient is then colonized with C. A. direct contact C. fomite difficile.Your choices for 29-31: E. aviary B. fecal-oral D. vectorDescribe the stages in the development and course of an infection.Create a Pathophysiology of Dengue Hemorrhagic Fever (on how does it starts and how does it affects our body) by making a concept map.