Using the following expression vector and the insert of interest with flaking region (PCR product of gene Psy2 and flanking region), which of these possibilitieswill result in the expression of the cloned gene with the highest efficiency?Stul: 5'-AGG | CCT-3'3'-TCC|GGA-5SalI cuts: 5'-G|TCGAC-3'3'-CAGCT|G-5'ECORI: 5'-G| AATTC-3'3'-CTTAA|G-5'Promoter P Styl SallEcoRIEco RIStulStart codonSallVector 25' TCCGGCGGAATTCCAAGGCCT3 AGGCCGCCTTAAGGTTCCGGApsy2CGTCGACTCCGGCGCAGCTGAGGCG 5' O A. Digestion of both component with Stul and SallO B. Digestion of vector with Sall and PCR product with StulO C. Digestion of both components with EcoRI and SallO D. Digestion of vector and PCR product with StulE. Digestion of both components with EcoRI and Stul

Restriction enzymes are special enzymes that nicks DNA at specific positions. It is mainly used in…

Using the following expression vector and the insert of interest with flaking region (PCR product of gene Psy2 and flanking region), which of these possibilities will result in the expression of the cloned gene with the highest efficiency? Stul: 5'-AGG|CCT-3 3'-TCC GGA-5 SalI cuts: 5 -G|TCGAC-3' 3'-CAGCT|G-5' ECORI: 5'-G|AATTC-3' 3'-CTTAA|G-5' Promoter P StyL_ Sall EcoRI Eco RI Stul Start codon Sll Vector 2 TCCGGCGGAATTCCAAGGCCT SAGGTTCCGGE psy2 CGTCGACTCCGGC 3' GCAGCTGAGGCCG 5'

Using the following expression vector and the insert of interest with flaking region (PCR product of gene Psy2 and flanking region), which of these possibilities will result in the expression of the cloned gene with the highest efficiency? Stul: 5'-AGG|CCT-3 3'-TCC GGA-5 SalI cuts: 5 -G|TCGAC-3' 3'-CAGCT|G-5' ECORI: 5'-G|AATTC-3' 3'-CTTAA|G-5' Promoter P StyL_ Sall EcoRI Eco RI Stul Start codon Sll Vector 2 TCCGGCGGAATTCCAAGGCCT SAGGTTCCGGE psy2 CGTCGACTCCGGC 3' GCAGCTGAGGCCG 5'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 20QP: Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant...

See similar textbooks

Similar questions

Given the following Western blot results showing levels of proteins over time in three yeast cell extracts after the induction of high level expression of the CDH1 protein. WT GAL-CDH1 GAL-CDH1, cdc23-1 0 30 60 120 0 30 60 120 0 30 60 120 Time (min) | Pds1 - Clb2 - Ase1 - Kar2 Note: The GAL-CDH1 indicates that the yeast strain contains a transgenic cdh1 gene under the control of the GAL promoter. This means that the researcher can control expression of that cdh1 gene. In these three experiments (three yeast strains), time O is the point at which GAL- controlled genes begin to get expressed (WT lacks transgenes). which is a component of the A In this experiment, four proteins are being probed for in three different yeast strains (1. wild-type, 2. a strain containing the cdh1 gene under GAL control (see note), and 3. the GAL-CDH1 strain that is also harboring a cdc23 loss of function allele (allele The upper (larger) band in the Ase1 lanes is non-specific background band; disregard it.…
Below is a portion of an exon from a gene that encodes protein X in the genome of the plant Arabidopsis. Wildtype DNA3’ TTC AAT GCT CCG AAT ACC 5’ template strand5’ AAG TTA CGA GGC TTA TGG 3’ non-template strand A new strain (Strain B) of Arabidopsis is identified with the same region of the gene coding for protein X: 3’ TTC AAT GCT CCC AAT ACC 5’ template strand5’ AAG TTA CGA GGG TTA TGG 3’ non-template strand Compare the two DNA sequences and look for any differences. Based on what you find a. There is no mutation in Strain B compared to Strain A. b. After the point of the mutation, all the amino acids encoded by the Strain B template will be different than the Strain A protein X. c. Protein X made from the Strain B template will be much shorter than protein X made from the Strain A template d. Protein X from Strain B will have one amino acid difference that would not affect protein function. e. There is a mutation but there will not be any difference in the…
Given the following Western blot results showing levels of proteins over time in three yeast cell extracts after the induction of high level expression of the CDH1 protein. WT GAL-CDH1 GAL-CDH1, cdc23-1 0 30 60 120 0 30 60 120 0 30 60 120 Time (min) - Pds1 - Clb2 - Ase1 - Kar2 Note: The GAL-CDH1 indicates that the yeast strain contains a transgenic cdh1 gene under the control of the GAL promoter. This means that the researcher can control expression of that cdh1 gene. In these three experiments (three yeast strains), time 0 is the point at which GAL- controlled genes begin to get expressed (WT lacks transgenes). In this experiment, four proteins are being probed for in three different yeast strains (1. wild-type, 2. a strain containing the cdh1 gene under GAL control (see note), and 3. the GAL-CDH1 strain that is also harboring a cdc23 loss of function allele (allele 1), which is a component of the A The upper (larger) band in the Ase1 lanes is non-specific background band; disregard…
Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA
Below is a portion of an exon from a gene that encodes protein Y in the genome of the plant Brassica. Wildtype DNA3’ CTT AAT GCT CCG AAT CCA 5’ template strand5’ GAA TTA CGA GGC TTA GGT 3’ non-template strand A new strain (Strain X) of Brassica is identified with the same region of the gene coding for protein Y:3’ CTT AAT GCT GCG AAT CCA 5’ template strand5’ GAA TTA CGA CGC TTA GGT 3’ non-template strand Compare the sequence of Wildtype with Strain X DNA, and note the following: Whether there is a mutation. If there is a mutation, what is the type of mutation (be as specific as possible) and explain the rationale for your decision. Assuming this is the only difference between the Wildtype and Strain X, describe the potential impact of the mutation on the structure and function of the protein.
Knock out mice that are mutant for a gene product X die. Variants of the X gene that were reintroduced through homologous recombination indicate that variant proteins that lack the C-terminal region of the protein cannot rescue the lethality (did not allow them to live), and always localized to the cytoplasm. Those that retained the C-terminal region rescued the lethality (conferred viability!) and were consistently localized within the nucleus. RNA-seq analysis of the mutant cells vs the wild-type cells indicated that the expression of many genes that are essential for neural function was reduced in the knock-out mutant cells. The N-terminal region of Protein X is 100% conserved between mouse and humans at both the amino acid and the nucleotide level. The predicted mouse mRNA sequence is shown below where the AUG corresponds to the translational start site (AUG). 5’-AUGUUUACAGAGGGGAAU... -3’ d) What motif could be present to direct this protein to its correct destination? e)…
Knock out mice that are mutant for a gene product X die. Variants of the X gene that were reintroduced through homologous recombination indicate that variant proteins that lack the C-terminal region of the protein cannot rescue the lethality (did not allow them to live), and always localized to the cytoplasm. Those that retained the C-terminal region rescued the lethality (conferred viability!) and were consistently localized within the nucleus. RNA-seq analysis of the mutant cells vs the wild-type cells indicated that the expression of many genes that are essential for neural function was reduced in the knock-out mutant cells. The N-terminal region of Protein X is 100% conserved between mouse and humans at both the amino acid and the nucleotide level. The predicted mouse mRNA sequence is shown below where the AUG corresponds to the translational start site (AUG). 5’-AUGUUUACAGAGGGGAAU... -3’ Q3a) Using a total RNA sample obtained from human cells, what is the first primer you would…
Utilizing Hind III and EcoR V Restriction Enzyme with Pet41 and the following gene of interest... a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg aactgcaatt ggacggtttc 781…
You have a 5.3 kb PstI fragment cloned into the PstI site of the vector pUC19, which is 2.7 kb in size. This vector has unique sites for the following enzymes in a multiple cloning site: PstI, HincII, XbaI, BamHI, SmaI, EcoRI A restriction map of the 5.3 kb insert is prepared. The recombinant plasmid is digested with the enzymes listed above in single digests, and then several combinations of enzymes are tested in double digests. The following bands are observed when the digests are run on a gel: Use the data above to construct a map of the cloned insert. Note that fragments smaller than 100 bp will not usually be visible on a gel, and that 2 fragments with a similar size will run at the same spot on a gel – resulting in a brighter band.
Several DNA coding for different proteins, CRISPR, or siRNAs against different genes were expressed in cultured normal human somatic cells (A–G; “-” = control: no expression of exogenous gene/siRNA). The cells were either untreated (-) or irradiated to induce DNA damage (+). After 24 hours, the cells were harvested for preparing cell-free extracts. Different proteins were then detected using SDS-PAGE followed by Western blotting. These include p53, the phosphorylated form of pRb as well as total pRb, the phosphorylated form of lamin B as well as total lamin B, and caspase 3 (note that the darkness of the bands roughly corresponds to the intensity of the bands in the Western blot). Fig.1. The cells were also analysed using flow cytometry. The x-axis is DNA contents (2N represents the position of DNA as in G1 phase; 4N represents the position of DNA as in G2/M phase); the y-axis is the accumulated cell number. Fig.2. (1) The first four samples are known (the rest, see below, are all…
What would three possible reasons be that a PCR wouldn't work after cloning a TAQ sequence into a His-tag vector making three different constructs and verifying via SDS-PAGE that the TAQ protein is there?
We are utilizing BL21 DE3 bacterial cells for the expression of the ADA protein via autoinduction. Create a schematic/figure showing the biological mechanism for expressing our desired protein in this cell line. We use the DE3 lysogen for expressing T7 polymerase and our plasmid has kanamycin resistance (not ampicillin).Create a schematic of this expression.