Answered: What is a carcinoma in situ (CIS)? Edit…

Science

Biology

What is a carcinoma in situ (CIS)? Edit View Insert Format Tools Table 12pt v Paragraph v d to search in

Understanding Health Insurance: A Guide to Billing and Reimbursement

14th Edition

ISBN:9781337679480

Author:GREEN

Publisher:GREEN

Chapter7: Cpt Coding

Section: Chapter Questions

Problem 31R

See similar textbooks

Related questions

Q: Your pregnant neighbor has been prescribed a daily dose of oral tetracycline for acne. Do you think…

A: Antibiotic are the medications prescribed to the patient against bacterial viral and protozoal…

Q: Can you help me the name of the labels?

A: Axon is a part of the neuron, which is a structural and functional unit of the nervous system. Axon…

Q: You are providing care to a victim who sustained a laceration to his left leg. The victim should…

A: Stitches, It mainly used to close the wound, thereby it helps in wound healing.

Q: ne struct photomicrographs tumen, mucosa, submueosa Jumen adventitla Submucusa -cartilage mucsa

A: Trachea wall layers : Lumen Mucosa Submucosa Hyaline cartilage Adventitia

Q: Fingerprint impressions that are not readily visible arecalled ___________.

A: Introduction: A fingerprint is a mark created by the friction ridges on a human finger. The…

Q: B A E D N F MIIC M K

A: Introduction: A group of genes that code for proteins found on the surfaces of cells that help the…

Q: Fill in the Punnett Square below. The first box is done for you. b b bb B

A: Punnet square is a square representation in which gametes from parent genotype are present on the…

Q: Fill in the Punnett Square below. The first box is done for you. b bb B.

A: Sir Gregor Mendel was a priest and a teacher who did the famous hybridization experiment on garden…

Q: Pathogens and Infections. Use the topic and relate the topic for initiation progression and…

A: Invasive ductal carcinoma (IDC) is considered the most common form of breast cancer that occurs in…

Q: tatus: * Question Completion Which letter in the figure represents phlanges? O A. A O B. B OC.C O…

A: The letter D depicting the body part is the phalanges. Phalanges are the bones that constitute the…

Q: Why was half of each plate covered with an index card?

A: UV stands for ultraviolet rays. They are electromagnetic radiation. Ultraviolet radiation mainly…

Q: Sequence dideoxy sequencing

A: Sequence dideoxy sequencing is also called Sanger sequencing.

Q: common household item that looks like the ovary and testes

A: Figs seeds hang in twos when they grow looks as two testis in scrotum.

Q: Mixing Embalming Fluids Mildred is 58 years old and died after falling down the stairs when she…

A: The process of preserving the dead bodies by treating them with a mixture of chemicals is known as…

Q: 15 11

A: Spinal cord is a long, tubular structure of the nervous system. It arises from brainstem and extends…

Q: 2. 3.

A: Brain is the largest organ in the body, and coordinates most body activities. Each part of brain is…

Q: Which of the following tests helps in diagnosis of cancer ? Urine test Neuro Test Blood test Biopsy…

A: Cancer is an abnormal tissue growth and multiplication of normal cells. Cancer cell divide rapidly.…

Q: hypertrophic scar characterized by.9 overproduction of granulation tissue and scar but not extend…

A: Wound healing It is the natural process of restoring a structural and functional ability of injured…

Q: Simple but creative caption on a poster about noncommunicable diseases caused by having unhealthy…

A: A non-communicable disease (NCD) is a disease that is not transmitted from one person to another.…

Q: The letters of the words are jumbled. Use the clue to figure out what the word is and write them on…

A: In this question asked about the jumbled words. Detailed solution in step 2.

Q: What will pose an ethical issue in these procedures are performed - mutilation?

A: Mutilation- : Mutilation refers to eliminating or amputating any body part from the body. Female…

Q: write the full form of LINEs

A: The transposons are the segments of genes that are capable of moving from one position to another…

Q: Body Covering: DNA: GGGAGTGTATACGGGATGAAGGCGATT MRNA: 12 protein: phenotype:

A: To make proteins transcription happen, which mean DNA(genes)>copy of gene>protein, this is the…

Q: B- D. F LEICASE G H I J

A: A compound light microscope is a microscope with more than one lens and its own light source.

Q: short description about gloves for health workers.

A: Gloves are personal protective equipment used by health care giver while medical or any surgical…

Q: ake table to differentiate ITP, TTP, HIT, DIC.

A: Platelets They are also known as thrombocytes, and they are crucial to the process of hemostasis.…

Q: what is the lung cancer sample collection

A: Introduction Cancer is a lifestyle disease which can be caused by abnormal or unhealthy lifestyle…

Q: What type of chicken is this

A: The chickens are domesticated fowl belonging to subspecies of the red junglefowl. Chickens are…

Q: Presentation: 32 year old male presents with four genital lesions which he states have been present…

A: Genital herpes is one of the most common sexually transmitted infections in male and females due to…

Q: What is the most commonly used technique in making sections in histology

A: The study of cells, tissues and organs by identifying them under microscope is called histology. The…

Q: According to the book Crawford, Dorothy H. Viruses: A Very Short Introduction, did the author…

A: Yes,Author Dorothy H.writes the book excellent ,that includes all the information related to virus…

Q: Choose incorrect statement about X rays OPTIONS X ray mainly used to look at the bones and joints…

A: X-rays are a type of radiation called electromagnetic waves that are used to create images of bone…

Q: Why is it necessary for pregnant women to strengthen their “pelvic floor”?

A: Pelvic floor is a muscular floor located at the bottom of the abdomen that stretches from the…

Q: A percutaneous is performed to treat osteoporosis-related compressionfractures.diskectomy…

A: Osteoporosis- Osteoporosis is a condition in which bones become weak and brittle due to that there…

Q: HgA HgB HgA HqB

A: Punnett square was named after Reginald C. Punnett. It is a diagram used to predict the genotypes of…

Q: Defend the statement "The investigations of Anthony Van Leeuwenhoek changes the world forever"

A: Antonie van Leeuwenhoek was a Dutch microbiologist who was born on October 24, 1632, in Delft,…

Q: The term ____ describes the ability of cancer cells to spread to other areas of the body. Group of…

A: When cancer cells break away from a tumor, they can travel to other parts of the body through the…

Q: Rosita Sanchez is 2 months pregnant, and she and her doctor are worried because her rash was…

A: Pregnancy is the process by which offspring is developed. there can be multiple pregnancy also mean…

Q: Steps or measures in order to see a bacteria under a microscope clearly

A: Bacteria are generally small unicellular prokaryotic organisms found in every environmental…

Q: pox, then add the text to the box and click Save'and Close.) edu gear (100

A: Thank you for the question Answer = A cell is a cytoplasmic mass that is enclosed by a cell…

Q: Identify the picture

A: A red swath of blood flowing from the cut to your heart. On the end, a pimple or a yellowish crust.…

Q: Discussion : Alfred Hershey and Martha Chase . INTRODUCTION (Topic): Who is the topic of discussion…

A: ALFRED HERSHEY was an AMERICAN bacteriologist and geneticist born in 1908. MARTHA COWELES CHASE was…

Q: this is a Skin

A: The skin is composed of two main layers: the epidermis, made of closely packed epithelial cells, and…

Q: Modified true or false. Write the correct answer if the underlined word is false.

A: Any organic molecule that consists of a basic amino group, an acidic carboxyl group, and a distinct…

Q: Write an essay about "Human and Human Body"?

A: Human beings are anatomically comparable and identified with the great apes yet are different by…

Question

What is a carcinoma in situ (CIS)?
Edit View Insert Format Tools Table
12pt v
Paragraph v
d
to search
in

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Why are new drugs for heptacellular carcinoma necessary? Highlight: - that the risk factors for hepatcellular carcinoma clearly indicate a large role for the micro environment
A percutaneous _____________is performed to treat osteoporosis-related compression fractures. diskectomy vertebroplasty
Easiest symptoms to diagnose carcinoma?
- vs Anatiomy and Bry 113. An 80-year-old woman comes to the physician because of a 2-month history of a lump in her right breast. Physical examination shows a 2 cm mass on ta nght beast wh direping of the overlying skin. Examination of a biopsy specimen confirms a diagnosis of carcinoma. Involvement of which of the folowing structure is the most belyse of the parts A) Areola B) Lactiferous ducts C) Retromammary bursa D) Superficial fascia E) Suspensory ligaments
What does the ABCDE mnemonic stand for in regards to suspicious skin lesions
The PAP test looks for early cervical cancer warning symptoms. False or true?
write a terminology in column B which meets the description of column A COLUMN A COLUMN B 1. Cointaining the protein Keratin 2. A stem cell that can give rise to another blood cells 3. Acell the enguifs foreign microscopic particles to initiate immune responses 4. Layered cells in a tissue 5. Belonging to glands with ducts 6. Glands that are ductless 7. The outermost connective tissue in body surfaces and surfaces of internal organs 8. Characterized by a fine network of fibres. 9. Epithelium that appears to be stratified, with all the cells connected to the basement membrane 10. Ability to break down protein
https://youtu.be/w7aIxiZQ60g Multiplexing agglutination https://youtu.be/uWStmyJ5Qc0 This is the multiplexing agglutination. Lab report I don’t really know what to talk about, the data, conclusions and the purpose of this. Need help please
Is omicron deadly
What is transorbital lobotomy ?
Mrs. A , age 35 was given a pap test during a routine medical check-up. The test showed marked dysplasia of cervical cells but no sign of infection. according to above information make you SOAP ( subjetive, objective, Assesment, and plan) noite
Post a histological appearance of a cell on its normal, reversible and irreversible injury state (aside from what is presented from the lecture). Identify the cell/s involved and the specimen.