Q: How does the presence of gill slits in all vertebrate embryos support the theory of descent from a…
A: Introduction :- A multicellular organism's embryo is the first stage of development. Embryonic…
Q: Which of the following is NOT a type of cell? A. ribosome B. haemocytoblast C. neutrophil D.…
A: Answer
Q: Gestalt theorists were interested in how we determine which part of the environment was more…
A: Gestalt theories Gestalt, experimental psychologists believed and suggested that the perception of…
Q: Contrary to legend, camels do not store water in their humps, which consist of large fat deposits.…
A: Introduction :- Fatty acids and lipids are other terms for fats. Three molecules are linked together…
Q: Draw the structure and give the name of a nucleotide made of adenine (A) and deoxyribose.
A: Nucleic acids are made up of nucleotide monomers that are polymerized to create long strands. The…
Q: Hardy-Weinberg principle
A: Definition: Hardy-Weinberg law of genetic equilibrium is that both gene frequencies and genotype…
Q: at factors in a population would mean that the Hardy-Weinberg principle does not apply? Give an…
A: Natural selection is one type of adaptive evolution mechanism. It happens because organisms with…
Q: After reading the paragraph below, answer the questions that follow. You're the manager of a factory…
A: The activity of the enzymes is subject to many conditions and situations. Factors like temperature…
Q: Please answer asap and in short Outline and summarise each of the four stages of qualification in…
A: Although a scale-down bioreactor can have multiple applications, our focus here is on appropriate…
Q: Why does the plasma membrane of a cell present a barrier to the movement of electrolytes through it?…
A: Introduction - The plasma membrane is a thin lipid bilayer that surrounds and protects the cell's…
Q: what would happen if the blue crabs population increased substantially/
A: The sapphire-colored claws of the blue crab give it its name. In mature females, the shell, or…
Q: of В C
A:
Q: The term 'ecosystem' was proposed by- (A) Odum (B) Tansley (C) Whitker (D) Goli
A: Introduction - Plants, animals, and other species, as well as weather and topography, all work…
Q: Identify a passive tissue that could be exposed to continued plastic stress (deformation). Explain…
A: Passive tissues are those that suffer muscle contraction when they are not stimulated to stretch but…
Q: worm Disease Produced Infective stage Mode of Transmission Intermediate and definitive host enolepis…
A: Hymenolepis nana and dimunita are the species of tapeworm. H. dimunita has slightly bigger eggs and…
Q: 1. What are oncogenes and tumor-suppressor genes? How are they involved in carcinogenesis? What is…
A: To explain: To explain about oncogenes and tumor-suppressor genes, carcinogenesis, and the relation…
Q: Genes are made by- (A) Histones (B) Lipoproteins (C) Hydrocarbons (D) Polynucleotides
A: The DNA or deoxyribonucleic acid is the genetic element in living organisms that determine the…
Q: The damaged ozone layer is situated in- (A) lonosphere (B) Mesosphere (C) Stratosphere (D)…
A: Introduction - Between 15 and 30 kilometres above the earth's surface, the ozone layer protects…
Q: 14. Why is titin important with respect to muscle contraction?
A: Titin (connectin) is an extremely long elastic protein, which runs parallel to the filament array…
Q: What is NADP and NADPH?
A: Cofactors Cofactors are the inorganic non-protein molecules or ions that are necessary for the…
Q: Assume you want to make and study fragments of a protein. Would you expect that any fragment of the…
A: Proteins are the polymers of amino acids.
Q: What are the importance of molluscs to other organisms, environment, medicine, etc.?
A: Introduction Mollusca is the second-largest phylum of invertebrate organisms after Arthropoda, with…
Q: Give 10 sentences about the concept of Epidemiologic lever.
A:
Q: 14. Why is titin important with respect to muscle contraction?
A: Titin is a protein encoded by a TTN gene. It is the largest protein in human beings.
Q: OBelow is a diagram of two models of protein sorting mechanisms. After analyzing the two models, how…
A: The protein targeting or protein sorting is the biological mechanism by which the proteins are…
Q: There are four bones of various types in the body. Name the three divisions (parts of the ear).
A: Introduction Bone:- It is living tissue that makes up the body's skeleton, It is made up of…
Q: Chromosomes contain- (A) Protein only (B) DNA and protein (C) DNA, RNA and histone (D) DNA, RNA,…
A: Introduction - DNA is bundled into thread-like structures called chromosomes in the nucleus of each…
Q: What is the major function of lysosomes? They: A. package proteins B. detoxify toxic substances C.…
A: Introduction -Lysosomes are membrane-enclosed organelles that contain a variety of enzymes that can…
Q: (a) Which would be easier to prepare bacterial smear from, liquid or solid culture? Why? (b) Aside…
A: Introduction A bacterial smear is a small layer of bacteria that has been stained on a slide. A…
Q: Consider the following protein sequence as an α helix:…
A: The sequence and identity of amino acids of a polypeptide chain make its primary structure.
Q: 1. After completing a life table for a population of beaver, you determine that the Net Reproductive…
A: A population is a changing entity and population growth refers to the change in the number of…
Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…
Q: Termites digest wood with the help of an enzyme secreted by the- (A) Salivary glands (B) Cells in…
A: Termites are insects that feed on wood. They get nutrients from cellulose found in wood.
Q: 6. You were asked by your laboratory instructor to prepare the following: 12 plates (use maximum…
A: The nutrient media contains essential nutrients to support the growth of microorganisms. Different…
Q: List (and explain) 2 tests/procedures related to Reproductive (Male/Female) Body system
A: Fertility tests are an important element of the evaluation and treatment of infertility. Your doctor…
Q: What is an example of a lab experiment that shows the variation of the photosynthesis efficiency in…
A: Introduction - The fraction of light energy turned into chemical energy during photosynthesis in…
Q: Medium/test Used Negative result Indicators, key regents, or key ingredients Positive result…
A: Dear student as per Bartleby policy i can solve first three parts only. Please post the remaining…
Q: During the seismonastic movement in Mimosa pudica turgor changes occur in- (A) Leaflets (B) Stipules…
A: Introduction - The types of movements and responses that plants display when they are stimulated are…
Q: Why medical marijuana can take place of non-steroidal anti-inflammatory drugs in the Philippines.
A: Medical Marijuana has an ability to treat chronic pain, muscle spasms, nausea and vomiting, is cheap…
Q: Kin selection explain eusocialty?
A:
Q: Which of the following commonly regulates enzyme activity in vivo? O a. An amino acid replacement O…
A: Introduction Enzymes are proteins that function as catalysts in biological reactions to speed up the…
Q: the yeast isolates are Cryptococcus neoformans and Candida albicans. what test will you do yo…
A: Fungus Fungus is a saprophytic, spore-forming organism that belongs to the domain Eukaryota. These…
Q: A nuclear power plant employee, 20 years old, was entered the hospital with a diagnosis of "acute…
A: Acute radiation sickness is condition which occurs in a person who has been exposed to a high amount…
Q: Three mechanisms by which membrane-bind-ing proteins bend a membrane are illustrated in…
A: Introduction Proteins are complex biomolecules and macromolecules that are made up of one or more…
Q: Plants with seeds and evergreen needle-shaped leaves, but no flowers would be: angiosperms…
A: Non flowerings plants grow from seeds are calles gymnosperm. It means 'naked seed'. Gymnosperns…
Q: Iron deficiency results in- (A) Leaf tip necrosis (B) Small leaves disease (C) Decreased protein…
A: Introduction - Iron is a key component of electron chains and a cofactor in a number of important…
Q: Which are considered Zoonotic diseases? Select all that apply. O Ebola O HIV O Rabies Hantavirus…
A: Disease is a kind of harmful condition which disturb or impairs functioning of body part or whole…
Q: g food spoilage. In the last 20 years, food prices ha and the United States Department of…
A: Answer :: 1. Causes of food spoilage and food poisoning.What is Food Spoilage?Food spoilage is…
Q: PROTEINS NUCLEIC ACIDS
A: Proteins serve a variety of purposes, such functioning as enzymes and hormones, regulating fluid and…
Q: Explain the monoamine theory for the etiology of major depression.
A: The Monoamine Theory of Mental Depression states that the low levels of norepinephrine and serotonin…
Step by step
Solved in 2 steps