What is the function of the sliding clamp at a replication fork?
Q: A person with Down syndrome has one less chromosome than normal. Select one: a. False O b. True
A: Down syndrome: This is a genetic disorder associated with abnormal or delayed physical growth,…
Q: In the RBCs of the patient described in the picture, which of the following would be expected?…
A: Glycolysis occurs in both aerobic as well as anaerobic respiration. Glycolysis is the only…
Q: 1. The following lipids are important structural components of the cell membrane of fish. Draw the…
A: The membrane phospholipids have a glycerol backbone.
Q: Enzyme: Crystal Structure of Wild-Type Human Phosphoglucomutase-1 (PGM1) the description of the…
A: The enzyme PGM1 is very well known for its central role in specific human metabolism, where it…
Q: topic: sds-page gel If APS is not available, what other chemicals can be used alternatively to…
A: APS stands for Ammonium Persulfate. It is an oxidizing agent that is used along with TEMED in order…
Q: Feedback See Periodic Table Which of the following correctly describe both a lectin and a…
A: Lectins are stated as either the proteins or the glycoproteins that are present in almost all…
Q: Which among the following statements is correct? Negatively-charged proteins are eluted out first…
A: Affinity chromatography is an analytical method for separating biomolecules in a mixture, based on…
Q: Explain the correlation between fasting and gluconeogenesis in terms of the hormone released by the…
A: From the non-carbohydrate source, glucose is synthesized called gluconeogenesis. It is a…
Q: Multiple forms of enzymes with the same catalytic activity but with different structures are called:…
A: Option (a) is incorrect because Holoenzyme:- The complete, biologically active conjugated enzyme (…
Q: Assume you were given a mixture consisting of one molecule each of all possible sequences of a…
A: Proteins are long chains of single amino acids. The human body uses 20 different amino acids in…
Q: 7. The standard free-energy change (in terms of net ATP production) when glucose is converted to 6…
A: All living organism except extremophiles metabolize carbohydrate particularly Glucose to meet up the…
Q: Why picric and tannic acid is used for the treatments of burn. Explain this in the concept of…
A: Tannic acid and picric acids are phenolic compounds. These are water-soluble compounds…
Q: A positive result for the Ninhydrin test yields a deep blue or violet-blue color of the soluti more…
A: Ninhydrin test is a chemical test performed to detect the presence of amines or amino acids.
Q: Why are unsaturated fats considered healthier?
A: Unsaturated fatty acids consist of a double bond between molecules of the fatty acid chains, whereas…
Q: 9. L-lactate dehydrogenase: L-lactic acid:: Salivary a-amylase: a) D-aminoacid b) L-aminoacid c) a-…
A: All biological chemical reaction reactions in living beings are controlled by enzymes. If enzymes…
Q: 4. Synthesis of basic corticosteroids. Steroid: A. Testosterone. B. Aldosterone. C. Pregnenolone. D.…
A: Introduction: Corticosteroids are steroid hormones that are synthesized in the adrenal cortex. It is…
Q: The table below summarizes the results for Millon's test. Provide the correct remarks from the…
A: The amino acid tyrosine has a side chain containing a phenol group.
Q: Prepare a concept map connecting carbohydrate and lipid synthesis. Your map should include shared…
A: Carbohydrate metabolism : Carbohydrates are the most abundant molecule defined as a poly hydroxy…
Q: 3. Do enzymes act better under acidic or alkaline pHs?
A: Most favored pH value - the pH point where the enzyme has most activity - is known as the optimum…
Q: DNA scissors used in genetic engineering applications are called Endo nucleases Restriction enzymes…
A:
Q: The 6-member pyranose ring of glucose is formed through the interaction of the hydroxyl group on C5…
A: The carbohydrate glucose can form an intramolecular cyclic hemiacetal.
Q: CH,0--o CH;0-P-O ČH-OH C=O Ó. 10-C-H H-C-OH H-C-OH O C-H ČH;O-P-0 H-C-OH O CH-O
A: Glycolysis is the metabolic pathway that converts glucose into pyruvic acid.
Q: Calculate the free energy change for glucose entry into cells when the extracellular concentration…
A: Free energy change The change in free energy (ΔG) is basically the difference between the heat…
Q: Beginning an endurance training programme can increase body weight because in the first few days of…
A: As of now days we can see the obesity is major concern infornt of people , increase weight of people…
Q: What is the detection principle of iodine test for starch
A: The iodine test is a quantitative analysis of carbohydrates to distinguish polysaccharides from…
Q: Using a 1 cm cuvette, the absorbance at 260nm of your double-stranded DNA sample is 0.15. What is…
A: Lambert-Beer's law can be used to calculate the concentration of DNA in a sample. It states that the…
Q: 3. Draw the chemical structure of cholesterol and state its functions 4. Explain in detail the…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: te the structure for a generic triacylglyceride at pH 7.4.
A: ''Since you have asked multiple question , we will solve the first question for you . If you want…
Q: Question 8 Which of the following IS a Phase Il metabolic reaction? O Fornation of a ketone at a…
A: Question 8 ans: Phase l metabolism is when a parent drug is converted to polar active mrtabolite…
Q: What is cryopreservation? How do we reduce the risk of cell damage from osmolytic pressure in…
A: Cryopreservation is primarily used to preserve biological specimens. Individual cells and biological…
Q: Which of the following is true regarding the glycosidic bond between the pentose sugar and…
A: DNA and RNA are nucleic acids composed of nucleotide units. Nucleotides are composed of pentose…
Q: Which mayonnaise is thicker? Mixing oil to the mixture gradually or mixing all the ingredients in?…
A: Mayonnaise is a condiment used in burgers, salads, and sandwiches. Mayonnaise is considered as a…
Q: When using blunt-end primers, how would you determine the correct plasmid construct from the…
A: Ligation is the joining or ligation of two nucleic acid fragments through the action of a ligase…
Q: How many types of histone proteins are present in eukaryotic chromatin? 3
A: In the nucleus of eukaryotic cells, histones are highly basic proteins with a lot of lysine and…
Q: Starting with a 4-carbon growing fatty acid attached to the ketoacyl synthase (KSase) site, and a…
A: Fatty acid metabolism includes Fatty acid biosynthesis (an anabolic process) and β-…
Q: What Type of guard column, separation column, and suppressor used for anion- exchange chromatography
A: In the anion-exchange chromatography, the process of separation occurs which is based on the charges…
Q: Which polymerase transcribes genes with internal control regions (ICR)? O RNA Pol I RNA Pol III RNA…
A: The eukaryotic cells have three distinct RNA polymerases that transcribe different sets of genes.
Q: Phosphorylation of elf-2 regulates eukaryotic protein synthesis initiation by inhibiting formation…
A: eIF2 in question stand for Eukaryotic Initiaon Factor 2 is a heterotrimeric protein consist of…
Q: Three [BIOMOLECULES] Instructions; — Answer the questions properly. — Do not copy in Google or…
A: Fatty acids are hydrocarbon chains with a carboxylic acid group. Fatty acids are classified as…
Q: Proteomic analysis by mass spectrometry involves digestion of samples with to generate peptide…
A: Tandem mass spectrometry is a major technique for the peptide/protein sequencing and PTM analysis.
Q: 4. Since pepsin is a gastric enzyme, does it have an acidic or alkaline optimum pH? What happens to…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: explain the function of present vitamin c in oxalic acid
A: Many plants contain oxalic acid, which can be found in leafy greens, vegetables, fruits, chocolate,…
Q: What is the final enzyme used in the biosynthesis of stearate (C18:0)? A. Elongase B.Beta-Ketoacyl-…
A: Fatty acid biosynthesis occurs in the cytoplasm of the cell. Fatty acids are the long-chain…
Q: etabolism as a determinant of bioavailability: the first-pass effect
A: Bioavailability is the rate and a particular range of the active ingredient absorption , when it…
Q: Which isotope did Hershey and Chase use to label the nucleic acid in bacteriophage T2
A: Alfred Hershey and Martha Chase experiments performed a series of experiments in 1952 which helped…
Q: How many molecules of water are produced by the electron transport chain during the complete aerobic…
A: Stearate is saturated fatty acids and C18:0, 18 carbon atoms. It is metabolized by beta oxidation in…
Q: How is Pyruvate Kinase Deficiency (PKD) inherited? What gene is responsible for the expression of…
A: Pyruvate kinase is an enzyme that regulates cell metabolism by catalysing the conversion of…
Q: What is the possible drug interaction in the following structure of phenoxybenamine?
A: Phenoxybenamine is a haloalkylamine drug which is used to treat hypertension. Haloalkylamines does…
Q: With the aid of diagrams describe the signalling pathway involving inositol 1,4,5 trisphosphate from…
A: Membrane phospholipids can act as precursors from which second messengers can be produced during…
Q: Acetyl CoA + 2H* + 2e = pyruvate + COASH Ubiquinone + 2H* + 2e = Ubiquinol E* = -0.48 V E" = +0.04 V…
A: If the reaction has a positive value of standard cell potential/standard reduction potential or a…
94
Step by step
Solved in 2 steps
- In the scenario where a single strand break occurs in the DNA replication fork: a) What would happen if RecC failed to bind to the chi site? Explain briefly and draw out the step at which recombinational DNA repair would stall. b) What would happen if RecA failed to bind DNA? Explain briefly and draw out the step at which recombinational DNA repair would stall. c) Draw the resolved product of this Holliday junction if it's cleaved in the direction of the white triangles. Is the result a heteroplex or recombinant? A Strand Invasion Ⓒ Holliday Junction A ResolveWhat are the three special proteins needed to form the initial replication bubble?What is the benefit of having replication bubbles?
- The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sideIn DNA replication, the role of topoisomerase is to Question 11 options: a) "unzip" the double stranded DNA in front of DNA polymerase. b) maintain the single stranded DNA. c) supercoil the DNA after the replication fork has passed. d) relieve supercoil tension in the DNA in front of the replication fork.What is semiconservative replication and how does it work?
- a) Under normal conditions E. coli produces three DNA polymerases. State their functional similarities and differences. b) List the other proteins and enzymes involved in DNA replication in E.coli and give their functions.What is the purpose and benefit of the polymerase chain reaction?What is the role of the metal ions in the polymerase active site?