What proportion (in %) of the CFTR gene/DNA sequence is represented in the CFTR mRNA? The mRNA contains a 5’ UTR, ORF, and 3’ UTR. What proportion (in %) of the mRNA is represented in the ORF?
Q: al mRNA: 5’- AUG GGC UCG ACC UUG -3’ Mutant mRNA 1: 5’- AUG GGC UAG ACC UUG -3’ Mutant mRNA 2: 5’-…
A: The physical and functional unit of heredity is the gene. They pass on knowledge from one generation…
Q: Are the following statements TRUE or FALSE?
A: a.It is a false statement. Post transcriptional RNA processing occurs in the nucleus of the cell and…
Q: The following is the only intron sequence of a gene that will be excised during the maturation of…
A: RNA splicing is the process of removal of non coding sequences called as introns and joining of…
Q: mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping.…
A: A codon is a triplet of the mRNA sequence, which identifies an amino acid. The genetic code tells…
Q: Processing of primary mRNA transcripts in eukaryotic cells DOES NOT involve which of the following?…
A: Ans:-C 1.What end does the poly A tail attach to? 3′ end A poly (A) tail is added to the 3′ end of…
Q: Bacteria use the same stop codons as eukaryotes. However, bacterial transcription is also terminated…
A: The transcription in prokaryotes is either terminated by rho-dependent or rho-independent process or…
Q: Which sequences within the pre-mRNA determine where splicing occurs?
A: RNA splicing is a process that produces a mature mRNA from a pre-mature mRNA. The process is started…
Q: How long would the peptide be that is translated from this mRNA sequence: AUGGGCUACCGA ? Group of…
A: Introduction :- In molecular biology, messenger ribonucleic acid is a single-stranded RNA molecule…
Q: How is it possible that a given mRNA in a cell is found throughout the cytoplasm but the protein…
A: Introduction The main crucial elements of the genome are the genes which controls all the cellular…
Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What…
A: The process of formation of mRNA from template DNA sequence is known as transcription. The process…
Q: The gene ABCD is 1500 bases long What would be the likely length of the pre-mRNA molecule? ____ What…
A: INTRODUCTION Exons are coding sections of an RNA transcript, or the DNA encoding it, that are…
Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3
A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…
Q: What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that…
A: Base sequence of mRNA Amino acid sequence UUG LEUCINE CCU PROLINE AGU SERINE GAU ASPARTIC…
Q: 11
A: Probably the earliest reference to age-related mental inadequacy is ascribed to Pythagoras in the 7P…
Q: The asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the…
A: Splicing is one of the most important modifications which take place during mRNA maturation. There…
Q: NASA has identified a new microbe present on Mars and requests that you determine the genetic code…
A: Introduction RNA is an abbreviation for ribonucleic acid, a nucleic acid found in all living cells.…
Q: Cells tend to have a relatively small and uniform size. Why aren’t cells larger? Discuss your…
A: Cell is the basic structural, functional and biological unit of all organisms.Cell is the smallest…
Q: For the following characteristics, state whether they are true for the 5' CAP, the Poly-A tail, BOTH…
A: Central dogma is the mechanism by which information of DNA is converted into a product (protein ) by…
Q: Geneticists are studying a malfunctioning protein that causes impaired endothelial cell migration…
A: The translation is a process of conversion of RNA codon sequences into their respective amino acid…
Q: Given the following mRNA sequence, write the peptide sequence that will result from protein…
A: mRNA stands for messenger RNA( Ribonucleic acid). Protein translation is a process of making…
Q: Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first…
A: DNA DNA is a genetic material from which amino acid sequence or polypeptide chain are made.
Q: If a gene sequence contains two poly-A sites, the first one in the middle of the sequence and…
A: Introduction: DNA contain the genetic information that transfer from one generation to another. The…
Q: Which of the followings best describes the histone mRNA structure? histone mRNAs end in a…
A: A histone is a protein that provides structural support to a chromosome. In order for very long DNA…
Q: How many copies of a protein can be produced from a single mRNA transcript? Many because copies of…
A: Transcription is the process by which an mRNA is synthesized from DNA which then undergoes the…
Q: Shown below is the 5' end of an mRNA molecule. What are the first three (N-terminal) amino acids of…
A: Through transcription the DNA molecule is converted into mRNA.
Q: If the mRNA transcribed for this gene will be translated into a functional protein, how many amino…
A: Introduction Gene expression is the process through which a gene's information is used to create a…
Q: In eukaryotes, which of the following statements is correct with regard to introns and exons?…
A: Eukaryotic DNA carries the nonprotein coding sequences.
Q: Predict what will happen when a cell growing in the presence of lactose contains a deletion of one…
A: An operon is basically a unit of the bacterial gene regulation and expression; which consist of…
Q: If a mutation were found where additional five G/C (top/bottom) base pairs were inserted immediately…
A: The mutation is a sudden and heritable change in the sequence of an organism's genome that gives…
Q: How many amino acid are in each of the two polypeptides produced? And how many nucleotides long…
A: The amino acids are produced by the DNA (deoxyribonucleic acid) through processes called…
Q: The eukaryotic cell is different from the prokaryotic cell. Outline the structural difference…
A: Cells They are the basic, fundamental entity of life.
Q: explain which sequences within the pre-mRNA determine where splicing occurs? How? Why?
A: Splicing of a pre-mRNA molecule occurs in several steps that are catalyzed by small nuclear…
Q: How many amino acids would be in this protein? Which of the five types of nitrogen bases is not…
A: Four types of aminoacids would be in this protein UCU--Serine AUU--Isoleucine GGG---Glycine…
Q: In eukaryotes, why is the initial RNA transcript usually longer than the mature mRNA molecule?…
A: Transcription is the process by which messenger rna is made from DNA. This process takes place…
Q: the space below, list the events that would occur during the processing of a primary RNA transcript…
A: In eukaryotes, however, the RNA transcript must undergo processing before it is a functional mRNA.
Q: Which of the following is true of the timing of RNA processing? The premise is false; mRNA…
A: In the nucleus, a newly made RNA or pre-mRNA also known as a primary transcript is produced via…
Q: What would be the effect on reading frame and gene function if:Answer each Two bases were inserted…
A: The nucleotide sequence may be DNA (deoxyribonucleic acid) or RNA (Ribonucleic acid). Nucleic acid…
Q: What is the mechanism for addition of a guanosine to create the 5' methyl cap of a MRNA? O The 5'-OH…
A: Mature mRNA is an mRNA that is modified post-transcriptionally. Mature mRNA carries information from…
Q: Which of the following sites would you predict to be present in the gene encoding a MRNA molecule…
A: mRNA known as messenger RNA carries the genetic information that is copied from DNA. mRNA contains…
Q: Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered…
A: Transcription is the process which are answerable for integrating the RNA from the DNA by the…
Q: A researcher studying late-onset Alzheimer's disease is interested in a gene, called ApoE, that…
A: Few important points should be kept : As we know non coding DNA is found within the most eukaryotic…
Q: Prokaryotic mRNA has some unique features compared to eukaryotic mRNA. Which of the following would…
A: Messenger ribonucleic acid (mRNA)--It encodes for the production of protein.mRNA is produced by a…
Q: For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table…
A: We are provided the mRNA sequence, and we need to write the amino acid sequence formed.
Q: Failure to add the 3’ polyA tail will result in which of the following? The prokaryotic mRNA cannot…
A: Post-transcriptional modification is the process by which certain changes are made in the newly…
Q: Which of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the…
A: Messenger RNA (mRNA) acts as the template for protein synthesis. Though mRNA is associated with…
Q: Which of the following is likely associated with the mRNA processing step of alternative splicing?
A: A process that helps a single gene to code for many proteins is known as alternate splicing. It is…
Q: The gene for Receptor Z contains an unknown number of untranslated first exons that are spliced to a…
A: * Given that the gene for receptor Z contains unknown number of untranslated first exons that are…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
What proportion (in %) of the CFTR gene/DNA sequence is represented in the CFTR mRNA?
The mRNA contains a 5’ UTR, ORF, and 3’ UTR. What proportion (in %) of the mRNA is represented in the ORF?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Based on the image below, select the correct statement. Complex II QH₂ Q- 10 2 HO 2 HO Fe-S (2.8 FADH₂ FAD- Succinate Fumarate https://canvas.uts.edu.au/assessment questions/356986/files/1562694/download? 2e verifier-eUTT3hYal2YYTWlywV8TIFA3USmzCsM52jECmvTo O Succinate is reduced to fumarate O Succinate is oxidised to FAD O The Fe-S center shuffles electrons from FAD to ubiquinone (Q) O The Fe-S center shuffles electrons from FADH2 to ubiquinone (Q) The Fe-S center shuffles electrons from FADH2 to ubiquinonol (QH2) W 88 16°CRecent - English (en) - 23/4/2022 a 12:00 e I La الاجابة تكون على شكل نص کتابي فقط و يمنع تحميل ملفات أو صور Lucy is a 58 year old female. She was brought to the emergency room following an acute respiratory distress. Her physical and laboratory examinations revealed signs of sepsis including tachycardia, hypotension, elevated body temperature, and marked increased in WBCS count in CBC. The initial diagnosis was sepsis secondary to pneumonia. Accordingly, she was admitted to the ICU and given intravenous antibiotic and treatment for pain. In the next day (second day), the nursing staff noticed hematuria, petechiae and Ecchymosis in her body. Therefore, a coagulation study was ordered and the obtained results revealed a thrombotic attack. BUN and creatinine were also elevated. Questions: 1. What is the most possible diagnosis in the second day? 2. What is the possible cause of hematuria, elevated creatinine and BUN? 3. What is the expected result for the following tests: PT, APTT, TT,…https://assignment.itslearning.ce X https://assignment.itslearning.c X .itslearning.com/mvc/Attachment/Get?Fileld=4rMyeCo2mEONWRK2cOFQzL2ygiD3VrOV2Au61%2fOZ%2f5to%2{6NE actice Problems and Homework_Dihybrid Cross Worksheet Dihybrid Practice Problems (1) Saved to itslearning it References Review View Help O Editing A A A 三、=、行 v 12 AaBbCc AaBbCc AaBbCc No Spacing x Aav 2 v A, 三、m、T Normal Heading 1 Paragraph smooth and white? Font Styles Two rough black guinea pigs when bred together have two offspring. One of them is rough white and the other is smooth black. What are the genotypes of these parents? 10. Parent 1 Parent 2
- variants/3043930/take/4/ In the table below, press the hotspots that correspond with the type of muscular tissue that matches each characteristic. Some characteristics may correspond to more than one tissue type. Select all of the correct answers. Characteristic 1. Voluntarily controlled 2. Involuntarily controlled 3. Banded appearance 4. Single nucleus in each cell 5. Multinucleate 6. Found attached to bones 7. Allows you to direct your eyeballs 8. Found in the walls of stomach, uterus, and arteries 9. Contains spindle-shaped cells 10. Contains cylindrical cells with branching ends 11. Contains long, nonbranching cylindrical cells 12. Displays intercalated discs 13. Concerned with locomotion of the body as a whole 14. Changes the internal volume of an organ as it contracts 15. Tissue of the circulatory pump Skeletal 000000 Cardiac · • .. . O O • Smooth ● · O Q All Charges Snedin Course: 23SPCMP Anat & Phys... The tissue type that is indicated by the black line is @ # M Question 32 - Lab Practical 1 -... $ % LM 320x 4+3:53 1 + t A 42.0 KB/S 7i ul l 62 chegg.com/homework-h 1 home / study / science / anatomy and physiology / anatomy and physiology questions and answers / asked with an image Your question has been posted. We'll notify you when a Chegg Expert has answered. Post another question. O Next time just snap a photo of your problem. No typing, no scanning, no explanation required. Get Chegg Study App Question: O Edit question Nerve Origin Movements muscles innervated Cutaneous or sensory innervation allary radial Muscilo-cutaneous ulnar median obturator Femoral nerve tibial Common fibular nerves Deep fibular nerve Superficial fibular nerve Sciatic nerve Gluteal nerves Pudendal nerves Mioinguinal nerve Lumbosacral nerves Expert Answero This question hasn't been answered COMPANY LEGAL & POLICIES CHEGO PRODUCTS AND SERVICES CHEGO NETWORK About Chegg Chegg For Good College Marketing Mobile Apps EasyBib Internships.com Advertising Choices Cheap Textbooks Cookie Notice Chegg Coupon Sell Textbooks…
- C Clever Porta x dng To Do ady G Edote Q2 2021 SCLGB 2 M x A Did you finish your interim? if no X i edcite com/apps/MOElemiewer7assignid-nhaadmin_1611780315611&exid-nhaassessments 1571155631555&acode C6G7L7 2021_SCI_G8 12 MI12465/2 OF 25 Question 2- Notes C Line Guide Reset Answer Use the information below to answer the question. Complete the sentence below to describe the relationship between sunlight and the rubber tree. If sunlight was not an available resource to a rubber tree, this process would The Amazon rainforest is the world's largest rainforest, famous for its vast biodiversity. Rubber trees are one of the many organisms populating the forest. When the bark is peeled back, it reveals a white, milky sap known as latex which can be used for making rubber materials and waterproofing items. They also produce fruits which when dropped burst open upon ripeness to reveal the trees not - take place because it is a necessary component in the reaction. seeds Rubber tree fruit (above)…R Chen 109 Lectures CpX + ecollege.com/course html courseld17809178&OpenumHMAC-a1cb6af2a694560835408ac3c7#10001 Propiem 2.37 - ENnanced with reedback A brain scan uses the radioisotope oxygen-15. The recommended dosage is 60 mCi. A supply of 250 mCi in 20 mL arrives at the lab. to search N 2 W S 3 X E All D S с R F S V T G 6 B Y H & 7 N J 8 Part A Home Provide Feedback 1 M How many m.I, will be injected into a patient? Express your answer to one significant figure and Value Submit K ( 9 End O Request Answer PgUp 0 Units Alt Pwand PgDn O 98 Up ?vclient.psonsvc.net/#/question/7a377747-fc73-49c1-8a0f-d949747f2105/1cb2bdeb-d647-4422-a833-50824ccb9eb7 Review - A Bookmark Washington, Saniyah heritance / 10 of 15 Sickle cell anemia is an autosomal recessive disorder. If each parent carries one sickle cell allele (Tt), what are the chances that their child will have sickle cell anemia? O A. no chance ов. one in four (25%) O C. two in four (50%) O D. three in four (75%)
- This is homework not a test! From NTSA case study https://static.nsta.org/case_study_docs/case_studies/cystic_fibrosis.pdf Please help with questions 2, 3 and 4 of part four 2. "The successful use of gene therapy to cure SCID syndrome (2000) is hoped to be a permanent cure for those patients because a good copy of the problem gene was inserted into the patients' blood stem cells in the bone marrow (hematopoietic stem cells). Once white blood cells enter the blood stream they have a limited life span, on the order of a few week to months. The blood stem cells are the cells that create more white blood cells to replace those that are lost. If the gene was only inserted into the circulating mature white blood cells, the patient would only be temporarily cured until those cells were used up or died." The current gene therapy approaches to cure CF involve inserting a functional CFTR gene into the mature epithelial cells of the lungs. In light of the preceding paragraph, do you think that…HEB Thursday - M M Inbox (158) HAC Home View Su X A web.kamihq.com/web/viewer.html?state=%7B'ids"%3A%5B 1dvxol57h6z004SawaUYeJo4xKCG613q5 %5D%2C'action"%3A'ope HE Course Modules: S A See the source ima. 6 New Tab A Classes HEB Course Modules: 7t. Winter Wonderland hebisd.edu bookmarks tudent Edu O O Camille Ervin - Monster Genetics_page_1.jpg Part 1 Procedure: 1. Flip a coin twice to determine the genotype for each trait and record it in the data table. Heads = allele 1, Tails = allele 2 (Example: if you fipped heads twice, your monster will hove two copies of ollele 1 for his genotype.) 2. Determine the phenotype resulting from the allele pair for each trait. 3. Repeat steps 1-2 for each trait and complete the female monster's Table 1. nary O Speech Table 1: Genotypes & Phenotypes for Female Monster Allele 1 Phenotype Trait Allele 2 Genotype Eye Two small eyes (E) One large eye (e) Eye Color (incomplete) Red (R) White (R') ment Skin Color Green (G) Blue (B) (codominant) Tail Shape 18…6:02 .ull a docs.google.com A * elastic cartilage contain • Elastic fibers • Collagen fibers • Both of elastic and collagen fibers * anemia is • Deficiency of erethrocyte • Increase of leukocyte O • Deficiency of platelets thrombocytopenia is deficiency of • Platelets • Red blood cells • White blood cells hyaline cartilage is covered by its own