When the disaccharide is hydrolyzed, the monosaccharide units that are produced are
Q: Uronic acids are another class compound for carbohydrates. a) Describe the structural difference…
A: Chemically carbohydrates are polyhydroxy acetone or ketones. Uronic acids are also carbohydrates…
Q: Experiment A. You replace spiperone with a radiolabelled drug that has a higher affinity for the D₂…
A: The log dose-occupancy curve is a graph that shows the relationship between the concentration of a…
Q: Tyrosine kinase receptors are pairs of proteins that span the plasma membrane. On the extracellular…
A: Ligand receptor system - consist of cell-surface receptors (membrane-anchored proteins) outside…
Q: Which side chain contains a carboxamide group? O R1 O R2 R3 O R4 Question 3 At pH=7, the net charge…
A: Proteins are complex biomolecules made up of amino acids. They play critical roles in the…
Q: Deficiency in HGPRT will lead to what? a. No synthesis of ATP b. No salvage pathway for all purines…
A: Hypoxanthine- guanine phosphoribosyl transferase (HGPRT) is required in salvage pathway which is…
Q: Which outcome most likely results from exposure of Ogg1 mice to TNFa O A. Increase in cancer…
A: DNA and RNA are biomolecules that carry genetic information between different generations of cells.…
Q: Buffers in pharmaceutical and biological systems
A: The pH of a solution refers to the concentration of H+ ions in a solution. If the H+ concentration…
Q: - Draw the graph A340 = f(t). Comment the shape of the curve Calculate alanine, LDH, NADH and…
A: If a particular reaction brings about a measurable change (like the generation or consumption of a…
Q: describe the principal reactant and products of major steps of glucose oxidation
A: Three distinct metabolic pathways are involved in cellular respiration, which is where glucose…
Q: 1. What is gluconeogenesis? 2. Explain the biochemical effects underlying the metabolic functions of…
A: Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: Pls send solution fast within 10 minutes and i will give like for sure Solution must be in typed…
A: a) The total binding constant, K, is the product of the individual binding constants K1 and K2: K =…
Q: 4. At pH 9.5, what is the net charge of the peptide LTDQRHGE?
A: Peptide is composed of polymer of amino acids (length of 13 to 17 amino acids) which is linked by…
Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…
A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…
Q: I'd like you to explain to me the structure of one of your macromolecules. You should be describing…
A: Bio molecules or biological molecules that are formed in the body of living organisms. These are…
Q: 3. Please draw the core structure of Lignan, and numbering the C-atoms.
A: In 1948, Haworth first introduced the term "Lignan", which are also subgroup of non-flavonoid…
Q: The AG of a reaction is positive. Which is TRUE? The cell cannot catalyze this reaction under any…
A: In a general reaction such as: A + B ⇌ C + D At equilibrium (steady state), the concentration of…
Q: 1. Why is β-carotene less polar than chlorophyll b? Mention any TWO functional groups which make…
A: Beta-carotene- an isoprenoid compound, synthesized in plants, fungi, is an accessory pigment…
Q: Question 3 The amino acid histidine is very important biologically and can also be used as a buffer.…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…
Q: 1. What are buffers? 2. Using the pH scale, describe how you can indicate if the blood solution is…
A: Buffers are chemical systems which allows a solution to have a stable pH. Most buffers can help…
Q: In humans, the biosynthesis of L-glutamine is catalyzed by the L-glutamine synthetase. The global…
A: A negative ∆G value for a reaction implies that the reactants, or initial state, have more free…
Q: The standard Gibbs (free) energy of reaction (A,Gº') of the following reaction is equal to zero (at…
A: Gibbs free energy is the energy released by a reaction when proceeded under constant temperature and…
Q: The catalytic mechanism of an enzyme found in the mitochondrial matrix (pH = 7.8) depends on an…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: 10. Coenzyme used in electron transport. 11. It contains an apoenzyme and a metal ion cofactor. 12.…
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They are also called…
Q: Peptides have been discovered that display anti-inflammatory properties and show promise as new…
A: MTADV is a synthetic pentapeptide which can be a potential novel drug with anti-inflammatory…
Q: What is test for carbohydrates and why is it important?
A: Introduction. There are four different types of biomolecules present in our body, carbohydrate,…
Q: Draw a two-stranded anti-parallel beta-sheet where each strand is 5 amino acids long. Use “R” to…
A: Two types of secondary structures are abundant in protein: alpha helix and beta sheets. The alpha…
Q: A patient receives an intravenous (IV) solution that flows at the rate of 150 mL per hour. How…
A: The intravenous solution is the fluids or any medicine that is directly given into the vein. It…
Q: Part Three: Metabolism: Your cells are going to USE the food they've been provided! Describe the…
A: Metabolism is the chemical reactions occurs in our body which changes the food into energy to run…
Q: Consider the same hypothesis: Bone cells treated with vitamin D generate an increased amount of bone…
A: 1 This hypothesis is an alternative directional hypothesis.It states that bone cells treated with…
Q: Which pathways are utilized in order to allow for glucose from glycogen to be converted to ribose…
A: Glycogen is a storage polysaccharide made up of D-glucose residues. When signalled, the cell can…
Q: Enzymes are essential to the processes of photosynthesis and cellular respiration. Names two factors…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Consider the following experimental data from another experiment: [S] 1.5 2.00 2.50 5.00 10.00 V (No…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: The concentration of protein in a solution can be determined via UV spectroscopy and colorimetry*…
A: UV spectroscopy UV spectroscopy is a technique which uses the absorption of ultraviolet radiation by…
Q: list the primary energy system out of these 3 (only pick 1) (TP-PC System, Glycolysis & Citric Acid…
A: Food is the composition of carbohydrates, fats and proteins. On digestion these macromolecules are…
Q: what is the dna concentration suspended in PO4 buffer at ph 7.0 that has an absorbance at 260 nm…
A: DNA concentration of a sample can be determined using spectrophotometry and measuring the absorbance…
Q: Why was it necessary to use phosphoaminophosphonic acid-adenylate ester (ANP) in the ATP synthase…
A: As per the chemiosmotic Model, ATP synthase is the enzyme that phosphorylates ADP with Pi as…
Q: Explain the localization and mechanism of acetone formation, under what physiological conditions…
A: Acetone is one of the type of ketone bodies formed in the human body. Ketone bodies are formed when…
Q: hat will happen to CRH secretion in a patient given very high doses of a synthetic glucocorticoid…
A: Glucocorticoids (or, more colloquially, glucocorticosteroids) are a type of corticosteroid, which is…
Q: data obtained by a group of students: Tube Results of Lugol's iodine Test 1 Yellow 2 3 4 5 Light…
A: Introduction Starch is a polysaccharide or complex carbohydrate. It is made up of glucose monomers.…
Q: 3. Look at the label for Lindt chocolate bar below. a. Does this product contain animal fat? How…
A: (a)Plants and Animals have quite a difference in theor metabolic pathways. As a result of which…
Q: 6. A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCTGCTGACGCTGCTCGTCG-3'…
A: mRNA, or messenger RNA, is a type of RNA molecule that plays a central role in the process of…
Q: The steroid progesterone has an important role in the female reproductive system. Researchers…
A: “Since you have asked multiple questions, we will answer the first and third questions. If you want…
Q: The graphs 3 and 4 representing 1/Vo = f(1/[S]。) have been done in the presence of a competitive…
A: Enzymes carry out most of the processes required for life. They are protein in nature and carry out…
Q: (d) NH + (a) CH₂ CH₂ (b) O-H-- CH H-C CH₂ CH3 CH₂COOH H H CH₁ CH, (c) 5 5 (b) CH₂ CH₂ CH₂ CH CH (d)…
A: Proteins are the macro molecules that show diversity in their structure by possessing four levels of…
Q: Describe how will you dilute a 10X stock solution into 5X, 2X, and 1X, respectively.
A: INTRODUCTION : Diluting a Stock solution - A stock solution is a high or medium concentrated…
Q: 1. Draw the structure of a cholesterol ester where cholesterol is esterified with palmitic acid. is…
A: The four classes of biological macromolecules are nucleic acids, proteins, lipids and carbohydrates.…
Q: Which of the following has the lowest probability of cardiac event-free survival? high CRP and…
A: Introduction LDL (low-density lipoprotein) is also known as bad cholesterol. It can cause blockage…
Q: 1.a)From the countries listed which one has the highest percentage of household expenditure towards…
A: Food is an essential requirement for any organism. Food is any substance that is consumed by an…
Q: Students carry out a laboratory experiment with avidin (a protein in eg white) having a very high…
A: Enzymes are proteins that catalyse biochemical reactions. Sometimes enzymes require a non-protein…
Q: Given the lipid structure below, part A was derived from __________ while part B was derived…
A: Glycerophospholipids have a structure similar to triacylglycerides, except that they are polar. They…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 42/quizzes/36067 TEST 1 Supply the missing enzymes/product that is labelled with color yellow box and number. ALL ANSWER MUST BE ON LOWERCASE FORM E.i (fructose-1,6-biphosphate or glyceraldehyde-3-phosphate) HOH ADP HOH HOH CO ATP ADP HOH ATP HOH O, HC-OHO Phonphohurts esse HO 1. Glyceraldehyde 3phospnate Glucose Gucose-6-phosphate Fructose-16-biphosphate NADP NADH H ATP ADP o. 0 H,0 ATP ADP CHO OH Ase Phosphoenopynuvate (PEP) 2Phosphoglycerate 1,3-BisphonptoglycerateRelative Rate of Activity 2 pH 10 12 Gastric Protease Intestinal Proteaseurses / MEDBAS145en 21-22Spring / 2021-2022 Spring Semester / Final Which of the following pairs depict the absolute specificity of the enzyme? Select one: O O O O a. All of them b. Hexokinase - Glucose c. Lactase - Lactose d. Lipase - Triacylglycerol
- Y ANTIBODIES DIETARY B12 PERNICIOUS ANAEMIA HYDROXYCOBALAMIN 5. Pernicious anemia is a disease in which the intestine is unable to absorb vitamin B12, frequently due to the loss of the generically named "intrinsic factor" produced by the parietal cells of the stomach lining. Intrinsic factor is a glycoprotein that binds to vitamin B₁2 and is required for its uptake in the ilium. Vitamin B12 is synthesized only by microbes, and we get it either from digesting animal protein or from our commensal microbiome. Vitamin B₁ is unique among metabolic cofactors in that it contains the trace element cobalt, coordinated in a corrin ring structure that is similar to the porphyrin ring system in heme. Loss of intrinsic factor, often through autoimmunity, results in the inability to absorb B12 and ultimately a loss of red blood cells that results in anemia and can be deadly ("pernicious"). ILEUM NUMBNESS (a) In pernicious anemia, N 5-methyltetrahydrofolate accumulates, and cells run out of…DIAGNOSIS METABOLIC METABOLITES DISORDERS Alkaptonuria SYMPTOMS Phenylketonuria Gout Ketosis Fatty liverAcetyl CoA can be converted to all of the following except ________. ketone bodies fatty acids polysaccharides triglycerides
- 5. Matching Type Match Column A with Column B. Write your answer on the space provided. CAPITAL letters only. Column A Column B 1.. Citrate → Isocitrate 2. Fumarate → Malate 3. Fructose-1,6-bisphosphate → G3P and DHAP 4. PEP → Pyruvate 5. a-Ketoglutarate → Succinyl-CoA 6. Substrate-level phosphorylation 7. Oxidative decarboxylation 8. Reduction 9. Isomerization 10. Condensation 11. Fumarate → Malate 12. Citrate → Isocitrate 13. Succinate → Fumarate 14. Succinyl-CoA → Succinate 15. Malate → Oxaloacetate 16. Pyruvate → Acetaldehyde 17. Pyruvate → Acetyl-CoA 18. PEP → Pyruvate 19. 2-Phospoglycerate → PEP 20. Glucose Glucose-6-phosphate A. Succinate dehydogenase B. Succinyl-CoA synthetase C. Malate dehydrogenase D. Fumarase E. Citrate synthase E. Isocitrate → a-Ketoglutarate F. 3-Phosphoglycerate → 2-Phosphoglycerate F. Aconitase G. Acetyl-CoA + Oxaloacetate → Citrate G. Glycolysis H. Pyruvate → Lactate I. Glucose-6-phosphate → Fructose-6-Phosphate K. Kreb's cycle U. Enolase V. Hexokinase…Please tell me what carbohydrate is not produced in the pentose phosphate pathway? glucose 6-phosphate glyceraldehyde 3-phosphate fructose 1,6-bisphosphate erythrose 4-phosphate fructose 6-phosphateThe polypeptide chains in insulin are held together by hydrogen bonds Group of answer choices True False
- 42/quizzes/36067/take Test 3 Supply the missing enzymes/product that is labelled with white box and number. ALL ANSWER MUST BE ON LOWERCASE FORM E.i (argininosuccinate synthetase) 1. Mitochondrial matrix Omithtne transcarbamoylase Ornithine Transfer Citrulline Transport system Transport system 2 Hydrolysis Condensation Aspartate Urea ATP HO AMP 21 Cleavage Cytosol OL口 ePatient M Patient R Concentration of HDL-Cholesterol 60 117 Concentration of Total Cholesterol 182 361 Concentration of Triacylglycerols 90 201 Concentration of LDL-C 104 204 Concentration of Apolipoprotein A in Trail 1 363 67 Concentration of Apolipoprotein A in Trail 2 325 49 Concentration of Apolipoprotein B 82 159 Comment these dataPane Vitamin Sources Role/Function Deficiency Name (if applicable) Vitamin A Key component of Vitamin C Involved in synthesis. Vitamin D Vitamin D acts as a hormone to regulate calcium. It works in three locations: Word Bank Intrinsic Factor Vitamin E Vitamin E works as an protecting cells throughout the body from oxidative stress. Phospholipids Rhodopsin Intestinal Bacteria Vitamin K Our make approximately one-half of our body's requirements. Bone Intestine Name of Deficiencies: and Thlamin Kidney Tryptophan Pellagra Neural Tube Defects Antioxidant Riboflavin Most of the riboflavin in our food intake is from the food group. Niacin Synthesized from Name of Deficiency: Deficiency during pregnancy increase the risk of a birth defect Dairy Wernicke Korsakoff Folate known as Beri Beri Collagen Fatty Acids Niacin Vitamin B6 Metabolizes tryptophan to Requires absorbed. Vitamin to be B12 Pantothenic Acid Synthesizes cholesterol, steroid hormones, and neurotransmitters. Cho Is part of in the…