Q: trace the development of a megapspore mother cell to the formation of mature embryo sac in a…
A: The development of a megaspore mother cell to the formation of a mature embryo sac is a critical…
Q: abbreviated name
A:
Q: Independent of any possible effects of trout, estimate the reduction in frog density caused by the…
A: Answer and Explanation : Trouts are only not added to two groups: group 1 (no trout, no parasite)…
Q: Using the trait in the previous question, identify the genotype and phenotype ratios from a cross…
A: Incomplete dominance dhffers with complete dominance in a way that in incomplete dominance the…
Q: Suppose your cells are missing an organelle. Pick an organelle and research what would happen to…
A: Organelles are the entities present inside the cell performing different functions. A cell contains…
Q: write the basic concept of epidemiology.
A: Epidemiology is defined as a science of public health that deals with the scientific,…
Q: discuss in detail about indicator microorganizm.
A: Introduction Microorganisms, for instance, bacteria and the viruses which are present in the water…
Q: Which energy system did you use for 5 mins of jogging (around the house or up/down the stairs)? what…
A: Cellular respiration is an important metabolic pathway by which energy in the form of ATP is…
Q: Glands 1. Adrenal gland 2. Pituitary gland 3. Pancreas 4. Thyroid 5. Reproductive glands Disorder…
A: There are vital organs called glands all across the body. They create and expel chemicals which…
Q: The physician has ordered acetaminophen every 6 hours for a child weighing 10 lbs. The…
A: Recommended low dosage of acetaminophen= 200mg/kg/24hrs Weight of the child= 10lbs= 4.5kg
Q: Problem #3 Hemophilia is a recessive trait carried on the X chromosome. What are the genotype and…
A: Hemophilia is a recessive disease meaning that when both the X chromosomes in females are affected…
Q: Biological Macromolecules, Fill in the blank: Elements Present C,H,O Macromolecule Carbohydrates…
A: Molecules such as carbohydrates, fats, proteins and nucleic acids are all different types of…
Q: Medium/test Gram stain TSA Eosin methylene blue agar (EMB) SIM motility agar Brewer's plate in…
A: In microbiology, different tests are used to test the presence of various microorganisms. The…
Q: Explain what epigenetic theory is.
A: Greek for "epi" means "on or above," thus "epigenetic" refers to elements other than the genetic…
Q: The genetic diversity of the moss Polytrichum commune was analysed in two peat bog ecosystems.…
A: A species' genetic diversity refers to the variation in its genes and genotypes. It is critical for…
Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…
A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…
Q: Construct a table similar to that in Figure 2.12 for the different stages of meiosis, giving the…
A: Introduction In sexually reproducing organisms, a kind of cell division known as meiosis results in…
Q: which plants are more adapted for the tundra?
A: Biome: It is a collection of plants and animals which contain the same characteristic for an…
Q: Describe a technique that will allow you to separate cells from media
A: ANSWER) There are various techniques which are used to separate the cells from the medium. Some of…
Q: Parameters Promoters Initiation Elongation Termination Differences in Transcription Process…
A: Transcription is the process in which the nucleotide sequences of a gene are transcribed into mRNA…
Q: What is the definition for “greenhouse gas” ?
A: Carbon dioxide is an inorganic biomolecule composed of two oxygen atoms that form a double bond with…
Q: Justify the importance of pharmaceutical legislation
A: The term "pharmaceutical" is an umbrella term related to discovering, studying, extracting,…
Q: 1. A person kept a diet without proteins for a long time, severally limiting proteins in food. In…
A: Introduction Various biomacromolecules like proteins, carbohydrates, along with vitamins and…
Q: Discuss why it has been suggested that in the future obesity may be treated with antimicrobial…
A: Obesity become a major health issue and can lead to various health problems such as heart disease,…
Q: Elaborate briefly on two distinct mechanisms of eukaryotic post-transcriptional gene regulation.…
A: Introduction :The regulation of gene expression at the RNA level is known as post transcriptional…
Q: Discuss the possible mechanisms by which HIV causes a long-term chronic infection, whereas Ebola…
A: Viruses are tiny infectious agents that can replicate only inside the living cells of organisms.…
Q: explain how one would determine which strand is leading and which strand is lagging in the…
A: Introduction DNA acts as a genetic material in our body. DNA is a self replicating molecule. DNA…
Q: What would be 1 or 2 good biology careers for Phylogeny, modern taxonomy, fungi, plants, and…
A: Phylogeny: This is the study of the evolutionary relationships between different species and groups…
Q: Mendel found that crossing wrinkle-seeded (rr) plants with homozygous round-seeded (RR) plants…
A:
Q: 2. The original Cell Theory helps explain the functions necessary for life. It was based on 3…
A: Theodor Schwann put out the classical cell hypothesis in 1839. This theory consists of three…
Q: 1. Why do autumn leaves turn yellow and fall?
A: Introduction:- Plants are photosynthetic eukaryotic organisms that can make their food by themselves…
Q: There are two main forms of secondary active transport (cotransport), referred to as antiport and…
A: There are a few important points : Active transport occurs against the concentration gradient and is…
Q: Explain why seasonal stratification of temperature and oxygen takes place in deep ponds and lakes.
A: The propensity of lakes to generate separate and distinct thermal layers during warm weather is…
Q: Name the connection between the hypothalamus and the posterior pituitary gland. What does it consist…
A: Pituitary gland is an endocrine gland that mainly consists of two lobes called anterior and…
Q: When a true null hypothesis is rejected in a hypothesis test, the researcher or analyst has A.…
A: The collection of methods in biology known as "experimental biology" focus on using experimentation…
Q: An enzyme speeds up a chemical reaction by reducing the number of hydrogen bonds amount of electrons…
A: Ans: Enzymes are the protein bodies that act as biological catalysts and help in speed up the…
Q: Stains are used because O they bind evenly to all str they reduce contrast and make it easier to see…
A: Staining is a procedure in microscopy where a specimen to be viewed under the microscope is…
Q: What does MRSA stand
A: Bacteria are diverse kinds of unicellular organisms belonging to the domain prokaryote because they…
Q: how vaccines mediate protection, including the modes of actions, sites of activity, and the immune…
A: vaccine is nothing but a biological preparation which provides acquired immunity to a particular…
Q: What are the genotype and phenotype ratios of potential offspring when a man with type AB blood…
A: Blood groupings are inherited. They follow a Mendelian pattern, which means they are the result of a…
Q: a) Give one example of where active transport is used within the body and explain the mechanism of…
A: Introduction As we know cell membrane is semipermeable and it allows movement of various molecules,…
Q: Which of the following techniques is useful for analysis of protein-protein interactions? a. Western…
A: Protein-protein interactions are crucial for predicting target protein function and drug-like…
Q: What is the indication that the orange syrup is deteriorating?
A: Food rotting is the procedure through which a product turns into unfit for consumption by the…
Q: Mrs. Kaur and Mrs. Sharma had babies on the same day at the same hospital. Mrs. Kaur took home a…
A: “Since you have posted a question with multiple sub-parts, we will solve first three sub parts for…
Q: In which of the following situations would we expect atelectasis to develop? A. pressure in…
A: Introduction The respiratory system is the biological system that consists of specific organs and…
Q: Describe the processes of meiosis and mitosis
A: "Since you have posted multiple questions, we will provide the solutiononly to the first question as…
Q: Determine the patterns of inheritance of the following X-linked dominant cases by giving the results…
A: X Linked dominant inheritance means the genes present in X chromosomes, if the gene has dominant…
Q: Select the choice that identifies the organism described in the following statement: The organism is…
A: There are different types of organisms present on earth. Some types are- Prokaryotes- these…
Q: describe the structure and function of spinal cord as part of central nervous system .
A: The central nervous system is made up of the brain and spinal cord (CNS). In humans, the spinal…
Q: Descriptive terms used to describe colony morphology: C Colony #: form:…
A: Bacteria grows on solid media in the form of colonies. *A colony is the visible mass of…
Which of the following are reproductive organs? Select all that apply
A. Root
B. Leaf
C. Stem
D. Seed
E. Fruit
F. Flower
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Choose the one answer that fits best. Which of the following statements regarding seed germination is NOT correct? O a. The first structure to emerge is the root O b. The root grows away from the light or down O c. Seeds can always germinate no matter what temperature and light conditions are d. There is no photosynthesis until green leaves emerge e. Enzymes inside the embryo break down nutrients during germinationFruit forms from a flower’sa. ovary.b. sepals.c. carpels.d. stigma.Give five plant examples each: A. Auxiliary or lateral budsB. Terminal or apical bud, C. accessory budsD. adventitious buds
- The flower part that contains ovules is thea. carpel. b. stamen. c. sepal. d. petal.Which of the following structures in a flower is not directly involved in reproduction? a. the style b. the stamen c. the sepal d. the antherA prothallus is: O a. Atype of gametophyte. O b. Found in the conifers for transporting the sperm. O c. Aprotective cover over the sporangia. O d. Aprotective cover found in cones, O e. Aflat sail that helps in wind dispersal of seeds.
- Which of the following terms is not associated with a male portion of a plant?a. megasporeb. antheridiumc. pollen grainsd. microsporeWhich of the following is NOT a component of a flower? a. Sepal c. Carpel b. Stamen c. Carpel d. BractWhich of these is found in seed plants?a. complex vascular tissueb. pollen grains that are not flagellatedc. retention of female gametophyte within the ovuled. roots, stems, and leavese. All of these are correct.
- Which one of the following parts of the pitcher plant becomes modified into a pitcher? A. StemB. leafC. stipuleD. petioleFlower shape and color can be linked to the process ofa. pollination.b. photosynthesis.c. germination.d. secondary growthGive five plant examples each: A. Floral budB. Bud thornsC. Hooks