Which of the following is correct about a symporter? it is a form of passive transport it moves one substance at a time against its concentration gradient it utilizes ATP it moves large substances using endocytosis/exocytosis none of the above are correct

Which of the following is correct about a symporter? it is a form of passive transport it moves one substance at a time against its concentration gradient it utilizes ATP it moves large substances using endocytosis/exocytosis none of the above are correct

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter3: Cells And How They Work

Section: Chapter Questions

Problem 5SQ: The passive movement of a solute through a membrane protein down its concentration gradient is an...

See similar textbooks

Related questions

Q: xplain how the following affect membrane fluidity: – Level of phospholipid tail saturation – Level…

A: A plasma membrane is a selectively permeable membrane. It is made up of phospholipids, proteins and…

Q: When taking the question, it would appear as: Consider global warming, a continual gradual increase…

A: Biological variety refers to the evolution of life from genes to ecosystems, encompassing the…

Q: A. Drawing of Cell in Distilled Water Mount: (with Label) H₂₂0 H₂O H₂O H₂0 Drawing of Cell in Normal…

A: Figure A is of The cell is in isotonic solution. The flow of water is from both the side until…

Q: Why was Anton van Leeuwenhoek's discovery so important? What is the significance of Edward Jenners…

A: Fact An unlikely scientist was Antony van Leeuwenhoek. He was a businessman from Delft, Holland; he…

Q: What are some other prezygotic reproductive barriers besides a mating dance?

A: Reproductive isolation is necessary for organisms to separate from their shared ancestors and propel…

Q: Weight loss increases the plasma concentration of organochlorides in the blood. Organochlorides…

A: During exercise, our muscles burn ingested food for energy and contract in response to a flood of…

Q: Draw a serial transverse section of 18 hour chick embryo.

A: 18 hour chick embryo. At this point, it is clear to see the core translucent area pellucida and the…

Q: QUESTION 5 f a family with 15 members, 9 members had the A specific example of incomplete penetrance…

A: Given Out of 15 families only 9 have mutation And out of 9 families only 6 shows the disease.

Q: Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the…

A: Principle of parsimony: The principle of parsimony is made use of when we need to determine which…

Q: Compare/contrast – passive diffusion vs. passive carrier-mediated transport – passive…

A: Transport The transport of molecules across the cell wall and cell membrane. It takes place by two…

Q: An explanation of the testosterone hormone structure (the functional groups and everything) - How…

A: Testosterone is produced by the interstitial cells of Leydig in testes in men. After secretion by…

Q: What is the difference between food chain ang food web? Explain

A: A biogeographic area where all biological organisms together live and reproduce comprises an…

Q: Please answer fast What you chose to eat, when you chose to eat, and how much you chose to eat is a…

A: Eating is the process of breakdown and chewing of food. Eating is necessary for providing energy to…

Q: B-lymphocytes convert into plasma cells, before they produce antibodies. Which of the following…

A: phagocytes, a type of living cell, devour or engulf other cells or particles through a process known…

Q: 18. The DNA sequence M, shown below, is the sense strand form a coding region known to be a…

A: * Frameshift mutation is a mutation in which insertion or deletion of nucleotide occurs which…

Q: Compare the homebased DNA extraction method with the Phenol:Chloroform extraction method.

A: DNA extraction is a method to purify DNA by using physical and/or chemical methods from a sample…

Q: alapagos nes Between 1973 and 1978, the population of ground finches (a type of small bird) on the…

A: Answer In 1973,1) The maximum length for the beak of birds was…

Q: Pasteur used an S-necked flasks to disprove spontaneous generation. Explain the experiments that…

A: Spontaneous generation is a hypothesised theory that attempted to explain the origin of life…

Q: The anterior pituitary releases tropic hormones. The role of these hormones is ... to receive…

A: Tropic hormones are hormones that have other endocrine glands as their target. Most tropic hormones…

Q: species are most broadly distributed, which have the smallest range? List at least 3 names per each…

A: Species of organisms are distributed worldwide according to their adaptation ability and the…

Q: Why are ion channels necessary to transport ions into or out of a

A: The plasma membrane is the external covering of a cell that separates as well protects its internal…

Q: List at least 3 common issues experienced by women in the second trimester of pregnancy.

A: Introduction:- Pregnancy is the time period in which the proper development of fetus takes place…

Q: Why is there a need to provide the magnification of a specimen drawn

A: Microscopy is used to visualise the objects such as tissues, cells, nanoparticles etc. which can not…

Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU

A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…

Q: What would be the result of the following? the centromere is missing from a cell a chromosome…

A: Introduction A chromosome is a lengthy DNA molecule that contains all or a portion of an organism's…

Q: Which group (Population A that stayed in the flat territory or Population B that moved to the rocky…

A: Genes are the hereditary units that control specific traits, different versions of these genes are…

Q: Which pair of amino acids is charged, polar, and has an amino group on its side chain? a)K, R b)N,…

A: Amino acids:- it is usually acts as building block of peptides and proteins. But, a lot of amino…

Q: . Distinguish taxis from a tropism. 2. What is thigmotaxis? Describe what happens when the…

A: Animals and plants are two distinct types of biological beings. As a result, the pathways that they…

Q: The following are the conditions that determines the direction of ions as it pass through the…

A: Ion Channel: Ion channels are membrane proteins that produce pores in the membrane and permit ions…

Q: Why is it said that photosynthesis and cellular respiration are reverse chemical processes?

A: Photosynthesis :-it is the process of production of food (oxygen and glucose) in the plants by using…

Q: Which of the following would inhibit the function of the JAK-STAT Pathway? Multiple answers A.…

A: JAK-STAT pathway is activated in response to cytokines (interferons and interleukins). The receptor…

Q: 2 things are wrong with the paragraph below. Write the word or words that would need to be changed…

A: Fermentation pathways are anaerobic pathways. These pathways are either present in anaerobic…

Q: Possible Symptoms of Diabetes Mellitus 1. Increased insulin production 2. Decreased insulin…

A: Diabetes mellitus Diabetes mellitus (DM) is characterized by increases blood glucose levels in…

Q: 4. You develop the covalently-acting irreversible kinase inhibitor ibrutinib shown on the left that…

A: Ibrutinib is a burton's tyrosine kinase (BTK) inhibitor authorized for the remedy of a couple of…

Q: skin color

A: Skin color: Skin color is determined by the pigment called Melanin even other things are also…

Q: O Biological O Phenetic Phylogenetic Parasympathetic 60 00 100 Blaypis (OUTGROUP) A beaver Dam, AZ…

A: Introduction A phylogenetic tree is a branching diagram or tree that depicts the relationships that…

Q: The following are the conditions that determines the direction of ions as it pass through the…

A: An electrochemical gradient is a gradient of electrochemical potential, usually for an ion that can…

Q: Describe critical concentration (Cc) • Describe actin/microtubule polymerization • Contrast “T” and…

A: Cytoskeleton is complex network made up of microtubules, intermediate filaments and actin filaments.…

Q: Which species is the better interspecific competitor: Lemna polyrhiza O Lemna gibba O Lemna…

A: Introduction When individuals of different species fight for the same resources in an environment,…

Q: If a person is severely dehydrated, explain what would happen to the plasma volume, hematocrit, and…

A: Water is very much important for living organisms including human beings. Different chemical…

Q: QUESTION 3 In Mendel's pea plants, round shape (R) is dominant to wrinkled shape (r), and yellow…

A: The inventor of modern genetics, an Austrian monk named Gregor Mendel, developed his rules of…

Q: Which of the following is the best description of a ligand? - A molecule that directly binds a…

A: Introduction : A cell, tissue, or organ that can recognise and react to a specific stimuli is said…

Q: 1. What did calcium ions do during fertilization in sea urchins?

A: Sea urchins are free-living echinoderms that have venomous, sharp, brittle spines covering them as…

Q: The _____________ plants died, partially decomposed, and became the fossil fuels? (choose all that…

A: Sphagnum Moss: There are over 380 recognised species of mosses in the genus Sphagnum, which is also…

Q: Due to climate change, food security is highly compromised. Sequentially explain recombinant DNA…

A: Introduction : The use of technology to alter or manipulate a biological system for human advantage…

Q: (c) As for the vectors to be used for cloning and expression, suggest two types of plasmids suitable…

A: Genetic engineering has the ability to enhance the flavor of meals, boost nutritious value, and even…

Q: Sickle-cell anemia is a human disorder caused by a recessive allele (HbS) for the hemoglobin gene…

Q: Which of the following occurs when red blood cells are transferred from an isotonic solution to a…

A: Many biological subdisciplines exist within cell biology. An illustration of this would be studying…

Q: According to Strassman and Queller, why is a mouse more of an organism than a biofilm? The cells in…

A: organism is a living thing, such as a plant, animal, or single-celled life form, or something that…

Q: Upper Intertidal Zone Lower Intertidal Zone Balonus kalenvides Chthamalus scellatus The diagram…

A: Introduction: Connell is an American ecologist, but because his research on how interspecific…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

Which of the following is correct about a symporter?

		it is a form of passive transport
		it moves one substance at a time against its concentration gradient
		it utilizes ATP
		it moves large substances using endocytosis/exocytosis
		none of the above are correct

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

In which situation would passive transport not use a transport protein for entry into a cell? water flowing into a heypertonic environment an ion flowing into a nerve cell to create an electrical potential glucose being absorbed from the blood oxygen moving into a cell after oxygen deprivation
Fill in the blanks with the following words: diffusion, endocytosis, solute pump, osmosis. The type of active transport in which sodium and potassium are pumped across a membrane using ATP is called a This passive process is where water moves in and out of a cell The type of passive process in which molecules move across the plasma membrane down a concentration gradient is called This process is where the cell engulfs extracellular substances by phagocytosis or pinocytosis
Which of the following is an example of active transport? Simple diffusion Protein pumps Facilitated diffusion All of the above
Which of the following membrane-crossing mechanisms requires energy? Active transport Facilitated diffusion Simple diffusion Passive transport Turgor
Which of the following is an example of active transport? Uniporter Aquaporins Na+/K+ ATPase All of the above
If a bacterial cell is placed in a hypertonic (hyperosmotic) solution: None of the other four answers describes what happens in a hypertonic solution There is no net movement of water either into or out of the cell The cell may undergo osmotic lysis Water moves through the plasma membrane into the cell Water moves through the plasma membrane out of the cell, causing plasmolysis
Which of the following is true regarding bulk transport? ATP is required to pump molecules against the concentration gradient Bulk transport is an example of passive transport Transport of large quantities of materials ATP changes the shape of a protein channel during active transport
Which of the following is related with getting the sodium ions inside the cell membrane 1_primary active transport2_secondary active3_simple diffusion4_facilitated
What is movement of cell against concentration gradient is called: osmosis active transport diffusion passive transport
A wilted flower placed in a vase of fresh hwater for several hours became stiff and stood erect. When it was placed in a salt solution, it wilted. From this information, which of the following statements BEST describes the cells of the flower? Group of answer choices hypotonic to both freshwater and the salt solution hypertonic to freshwater but hypotonic to the salt solution hypertonic to both the freshwater and the salt solution hypotonic to freshwater but hypertonic to the salt solution
Using the appropriate osmotic terms (hypertonic, hypotonic, or isotonic) describe what would happen to each organism in the following settings: A single-celled freshwater protist is placed into a beaker of salt water. A salt-water snail is mistakenly put into a freshwater tank. A head of lettuce is placed soaked in a sink of salt water. A carrot is soaked a sink of distilled, pure water.
Using the appropriate osmotic terms (hypertonic, hypotonic, or isotonic) describe what would happen to each organism in the following settings: A single-celled freshwater protist is placed into a beaker of salt water. A salt-water snail is mistakenly put into a freshwater tank. A head of lettuce is placed soaked in a sink of salt water. A bunch of carrots are placed soaked a sink of distilled water.