Which of the following statements concerning D-glucose in INCORRECT? O a. It is a monosaccharide. O b. O C. O d. O e. It is a triose. It has four chiral carbons. The sugar is an aldose. When dissolved in water, it exists as both cycli and linear forms in solution.
Q: 15-24 b) c) Identify the molecules oxidized and reduced in the following reactions: a) CH₂CH₂CHO +…
A: Many redox reactions occur during metabolism. Redox reactions necessitate the transfer or removal of…
Q: The presence of insulin causes the activation of phosphoprotein phosphatase. This leads to the and…
A: PFK-2 indirectly regulates the rates of glycolysis and gluconeogenesis. PFK-2 catalyzes the…
Q: Structure and properties of triacylglycerols, their biological role.
A: Triacylglycerols, also known as triglycerides, are made up of three fatty acids that are…
Q: when v=vmax/2，Km =（S） 1.why？？Need Explaination. What is V and what is Vmax？how is their relationship…
A: In Michael's menton kinetics, Enzymes are known to show Vmax at a particular concentration of…
Q: 4. If a non-science person asks you what protein folding is and how the concept is related to…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes that…
Q: The oxidized form of NADH is O NADH+ O NAD+ O NADOH O NADH2 -
A: Metabolism involves the use of many redox reactions. In redox reactions, electrons can either reduce…
Q: 4. Why does DNA use Thymine instead of Uracil?
A: DNA is the type of nucleic acid, double stranded poly-nucleotide chain which work as the genetic…
Q: . Effects of amino acid composition and sequence to protein folding
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: Please help me calculate BSA and Net Abs (explaination and details pls)
A: Bovine Serum Albumin (BSA) is the most commonly used protein in research. It is obtained from the…
Q: Just 15-3
A: Kequilibrium constant is the ratio of rate of forward reaction and rate of backward reaction and…
Q: a) Determine kcat (in units of sec-1) for a particular enzyme, given the following information: Vo =…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: 3..° i We seem to be constantly chasing the latest great oil to use for cooking and currently…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: Using the results of linear regression analysis (log(MW, kDa) vs Rr) from the protein standards,…
A: Given that the linear regression analysis data of a plot of Log MW (in kDa) vs Rf is given as:…
Q: In addition to the oxidation of cytochrome c by Comple transport systems, what other reaction is…
A: Introduction The electron transport chain (ETC) is the last part of aerobic respiration. An electron…
Q: Coupling ATP hydrolysis to glucose phosphorylation makes thermodynamic sense, but consider how the…
A: The two individual reactions i.e. glucose phosphorylation and ATP hydrolysis is given below, along…
Q: What shuttle mechanism transfers the electrons from cytosolic NADH into the mitochondria with the…
A: Mitochondrial inner membrane is impermeable to NADH. Hence, for transfer of NADH, it is first…
Q: Why is it critical that NAD* and FAD be regenerated inside the mitochondrial matrix rather than the…
A: NAD+ and FAD are coenzymes derived from vitamin B3 and vitamin B2 respectively. Both NAD+ and FAD…
Q: Why was it necessary to use phosphoaminophosphohlc (ANP) in the ATP synthase enzyme active site…
A: ATP (Adenosine triphosphate) is energy molecule which is pretty stable in aqueous solutions at pH…
Q: Suppose researchers studied the first chromosome of a new species and mapped three genes of…
A: The frequency of recombination is a measure of genetic linkage that is used to create a genetic…
Q: Draw the structure of the a-methyl-pyranoside form of mannose following the reaction of the sugar…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Glucose 6-phosphate is fed to a cell line capable of utilizing the pentose phosphate pathway and…
A: There is constant interplay between the Pentose Phosphate Pathway (PPP) and Gluconeogenesis. The…
Q: For the net production of a molecule of glucose from CO₂, ribulose-1,5-bisphosphate must react with…
A: Synthesis of glucose from phosphoglycerate occurs through the process gluconeogenesis. ribulose 1,5…
Q: Beer’s Law: In serum cholesterol analysis, if the grad. cylinder that measured the acetic acid…
A: A spectrophotometer can measure the amount of light absorbed by a biomolecule and we can use that…
Q: When a product inhibits an enzyme by binding to the active site, which of the following would occur?…
A: Introduction Enzymes are known as biocatalyst. They increases rate of a chemical reaction by…
Q: Could you help with part d? Create a speciation diagram for histidine by plotting Xi vs pH from pH =…
A: His is a basic amino acids with pKa value of its side chain ~6, amine and carboxyl groups pKa values…
Q: Finally, using the formula to convert between standard states, show that that your calculated values…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: 1. Name all the proteins that are in the DNA replication fork in E. Coli, and describe the functions…
A: Introduction DNA acts as genetic material in prokaryotes and eukaryotes. DNA replication is a…
Q: What is true about lipids? A. They are polar and therefore soluble in polar solvents B They are…
A: The four classes of biological macromolecules are nucleic acids, proteins, lipids and…
Q: provide 3 example pathway of oxaloacetate to other biomolecules.
A: Oxaloacetate is a four-carbon-containing organic compound. It acts as a metabolic intermediate in…
Q: How does ATP regulate the activity of PFK-1? ☐☐ ATP binds to PFK-1 at the catalytic site as a…
A: Glycolysis is a process in which glucose is oxidized & is converted to pyruvate and in that…
Q: Which of the following will contain plain Galactose? Heparin Keratan Dermatan…
A: Carbohydrates can be classified into different types depending on their size into the following…
Q: 1. Describe five major types of lipids.
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: A gerbil is fed a normal diet including 14C-lysine. After a period of time on this diet biopsies are…
A: Gerbils are mammals , so only mammalian metabolism can be used here. In the figure below showing the…
Q: Can human digest this trisaccharide？What bond is it between sugar B and sugar C？（be specific）
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Calculate the mass of invertase (in mg) and concentration of invertase (in mM) contained in a…
A: Enzyme Activity =Amount of product formedtime The conventional unit used for assigning enzyme…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: Do carbohydrates and sugars cause weight gain? Briefly Explain the answer.
A: Carbohydrates are biomolecules that act as the major source of energy. Sugars are carbohydrates with…
Q: Why is the name the "citrate cycle" a more accurate name for the metabolic pathway discovered by…
A: Critic acid cycle also called as tricarboxylic acid cycle is the second stage in aerobic cellular…
Q: The pancreas is an organ of mixed secretion. Endocrinely, beta-cells produce the hormone insulin,…
A: Pancreas has 3 types of cells: α cells secrete glucagon β cells secrete insulin δ cells secrete…
Q: (a) A pathway consists of 6 enzymes (p, q, r, s, t, u) that convert substrate J to product X at a…
A: Metabolic pathways are a series of biochemical reactions that convert one biomolecule into another.…
Q: Consider a membrane that has a very high content of phosphatidic acid on the inner leaflet of the…
A: Introduction Proteins are made up of amino acids. Protein plays various function in our body. Two…
Q: 4. Which one of the following requires an energy source? a. a large molecule transported with its…
A: Transport of molecules across the plasma membrane occurs through passive and active transport.…
Q: If the target protein is 0.1% of the total protein in the original mixture, a three-step…
A: Purification is a process by which impurities are removed from a sample and desired component is…
Q: Mannose is the C-2 epimer of glucose. Altrose is the C-3 epimer of mannose. Which of the following…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Calculate the number of moles of ATP produced from the complete oxidation of 900 g glucose in the…
A: Glucose that enters the cell produces ATP by respiration. The processes involved are glycolysis,…
Q: e. Write the equations involved in the neutralization process of antacids. (Gastrointestinal Agents)
A: Antacids are medicines that are used to treat acidity. Antacids cure acidity by reacting with acids…
Q: In the following structure, the carbon labeled [Select] carbon, the carbon labeled [Select] is…
A: Monosaccharides are the simplest units of sugars. All monosaccharides are either aldoses or ketoses.…
Q: All lipids are absorbed into absorptive cells of the small intestine by which process? Primary…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: is this protein folding funnel from a metamorphic protein? yes or no? is there one intermediate…
A: Anfinsen hypothesis postulates that under native conditions, the three-dimensional structure of a…
Q: 1.How many chiral center does D-Eranose have？ 2. How many stereoisomer are possible for D-Eranose.
A: Conformation is the different positions a molecule can twist into. Configuration is the arrangement…
Step by step
Solved in 2 steps with 1 images
- The sugar molecule shown below is the cyclic form of a/an___________and the anomeric carbon is in the position. HO-CH, H H OH O ketopentose; B O ketohexose; B O aldopentose; & H/OH OH H ketopentose; xWhich of the following is/are reducing sugar/s?why? A CHOH CHOH CHOH OH OH CHOH OH CH,OH OH OH он C CHOH OH CHOH CHOH HỌ CH2OH OH OH OH OH ÓH u tte Select one: O a. Conly, it is a monosaccharide with a free carbonyl group O b. A and B only, both disaccharides are made from aldoses O C. B, C and D, they have at least one free carbonyl group O d. A and D only, both disaccharides are made from ketosis O. e. B and D, each has a free carboxyl groupAmylose is comprised of glucose monomers connected by what kind of glycosidic bond? a (1 -->4) a (1 --> 6) b (1 --> 4) b (1 --> 6) None of the above
- Monosaccharides can be chemically modified by a variety of reactions. Aldoses can be by Tollen's reagent or Benedict's reagent. Monosaccarides can react with carboxylic acids, phosphoric acid, or sulfuric acid to form The hydroxyl group on carbon two can be replaced with a group to form sugars.Sphingolipids can contain of all of the following except O more than one choice O phosphate O Glycerol O a mono- or oligosaccharide Osphingosine.Show a(１３：1)Cis Fatty-acid that is △^10 and what it is called in Omega No man clay.tur. Compared to trans version would this one or trans have higher/lowr Melting.P?why?
- D-Glucose and D-Galactose are A H D C=0 H-C-OH OH C-H H-C-OH H_C-OH CH₂OH D-Glucose ketoses epimers pentoses enantiomers H ... н-с-он OH-C-H он-с-н H-OH CH₂OH D-GalactoseWhich of the following terms correctly describes the relationship between D-fructose and L-fructose? O epimers diastereomers O enantiomers O cis-trans isomersWhich of the following best describes an L-glucose? The hydroxyl group attached to the penultimate carbon is located at the left side of the structure. The carbonyl group attached to the penultimate carbon is located at the right side of the structure. The carbonyl group attached to the penultimate carbon is located at the left side of the structure. The hydroxyl group attached to the penultimate carbon is located at the right side of the structure.
- Explain the difference between aldoses and ketoses including its configuration of D and LDescribe how carbohydrates can be classified into functional group of aldoses andketoses and give one example of each group (name and structure).Shown here is a monosachharide. How many total forms of this sugar are there? 1 CHO H-2 он н-3 он на I I H4OH + 0 0 0 0 8 2 5CH₂OH 16