Which of the following statements is true fordouble-stranded DNA?All of the given choices are true.The amount of A is the same as the amount ofT, and the amount of G is the same as theamount of C.O The amount of A is the same as the amount ofG, and the amount of T is the same as theamount of C.The amount of A is the same as the amount ofC, and the amount of G is the same as theamount of T.

All cellular lifeforms have DNA as their genetic material. A double stranded DNA (dsDNA) is composed…

Answered: Which of the following statements is…

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Similar questions

The ratio of (A+T) to (G+C) in a particular DNA is 1.0. Is this sufficient data to determine whether the DNA is double-stranded or single-stranded please explain why or why not.
If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA polymerase, dTTP,dGTP and dCTP, what will be the sequence of the nucleotides that will be added? A. 5' ATCGCCGTAGGC 3' B 5' GGCATCCG 3' C. 5' CCGT 3' D 5'CCGTAGGC 3' E 5'GGC 3'
In a double-stranded DNA molecule, how are the sequences of each strand related to each other? The sequences are identical. The sequences are identical except that one strand nas a U where the other strand has a T. The sequences are the reverse compliment of eadh other and use the nucleotides, A, G. U, and C only. The sequences are the reverse complement of each other
Using your own words and including the phrases “5’ to 3’” and “3’ to 5’” explain how a double helix of DNA is antiparallel.
Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragment
When a double-stranded DNA molecule is exposed tohigh temperature, the two strands separate, and themolecule loses its helical form. We say the DNA hasbeen denatured. (Denaturation also occurs whenDNA is exposed to acid or alkaline solutions.)a. Regions of the DNA that contain many A–T basepairs are the first to become denatured as the temperature of a DNA solution is raised. Thinkingabout the chemical structure of the DNA molecule, why do you think the A–T-rich regionsdenature first?b. If the temperature is lowered, the original DNAstrands can reanneal, or renature. In addition to thefull double-stranded molecules, some molecules ofthe type shown here are seen when the moleculesare examined under the electron microscope. Howcan you explain these structures?
A strand of DNA has the specific sequence ATGGCTA. What would be the sequence of a complimentary strand of DNA?
Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAA
On the given choices, which of the following is incorrect about DNA?
The sequence of the DNA template strand is 3’–ATGGCAATAC–5’: What is the sequence of the DNA informational strand? What are the amino acids present in this sequence?
One stand of DNA reads: GACTTCAGATC Whay would the complementary strand be?
Franklin's X-ray crystallography work provided which of the following regarding the structure of DNA? (more than one answer may be correct so check all that apply) A It had a helical structure with more than one strand A complete helical turn is made after 20 bases O It replicates in a semi-conservative manner Purines are paired with pyrimidines

SEE MORE QUESTIONS

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning