I want to ask which one is forward primer and which one is reverse primer QuikChange II3. Find your DNA sequence by pressingLoad a file from your hard-drive:No file selected4. Load it.DNA: changenucleotide(s) to:orUpload Now -or- Upload Translatedor specify a DNA region to translate from.Select up to seven nucleotides that you want to change OSite 1Site 2U1aagilent.com/store/ +Insert between two checked nucleotides10 a19 g28 a37 g2111 aBrowse20 a29 c38 torO Delete a region between two checked nucleotides (Note: two checked nucleotides will not be deleted)c289c_g290a_c291t3g12 a21 a30 t39 c48 t57 a66 t75 g84193146 c47 t55 t56 t64 g65 a73 g74982 t83191 a92 gFinally, obtain your designed primer sequences.Design PrimersClear this form to load a new sequence:Clear InputPrimer sequences:Primer Namec289c_g290a_c291tOligonucleotide information:Primer Namec289c_g290a_c2911Primer-template duplexes:Primer NameOr, paste plain text or FASTA-formatted DNA sequence in the box below:atggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagettaccettaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgataccettattaatcatatcoaattaaaaaatattaattttaaaaaaaataaaaacattctcLength (nt.)4747Primer-Template Duplextgecatgeccgaag3-gtacgE5-catgeo|||||ABOUT AGILENT RESOURCESacggtaHelp in choosing a mutagenesis kitgtacgggetCONNECT WITH AGILENT f in4913 g22 c31 g40 c49 g58 g67 g76 cSite 385194 g▾Tm78.59°C78.59°CtoL5cSite 4V14 g23 tO 32 g41 c50 t59 a68 t77 a86 c95 gPrimer Sequence (5' to 3)5-catctttgaaagatatagtatgttcctgtacataaccttcgggcatg-35-catgcccgaaggttatgtacaggaacatactatatctttcaaagatg-3YSite 5AGILENTSOCIAL HUBSHOPPING TOOLS SUPPORT &6115 a24133 a42 a51 160 t69t78 c87 t96 aDuplex Energy at 68 "C-48.57 kcal/mole-49.09 kcal/moleSite 67a16g25134 g43 a5 :52 g61 g70 a79 a88 g197 gUpload Translated RegionSite 7L8g17 a26t35 t44153 a62 g71 a80 a89 t98 aaagatgacg||||||tttctac-51tg-31Yetge9c1827364554637281Energy Cost of Mismatches11.31%12.42%9099Follow UsAmiler

In order to make multiple copies of a double stranded DNA, two primer molecules are required; the…

Answered: which one is forward primer and which…

Science

Biochemistry

which one is forward primer and which one is reverse primer

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

A Meet - rfc-prp x A G-Unit 5: DNA an X 4 https://docs.goog x y google classroom xP Classes cs.google.com/forms/d/e/1FAlpQLSeyPC6Kmoa0k5JJd1DWGzqqRwaQQobHN0OdqFX_aDbV_6-bKw/formResponse x New Tab D YouTube Маps E Copy of Distance Le. Launch Meeting - . 2020 HORNETS 4N. O StudentVUE 2 Mr. Nussbaum Lan. A Graphing Lines Use the chart to determine the correct amino acid that this DNA would code for - ATA * 1 point GFL E D А Y STOP Alanine U Tyrosine C. STOP Stop V Valine GU Cysteine U Stop G Tryplophan R Arginine G А С U A Leucine S. K Serine A C L UGA Lysine Proline Аsparagine M START H. I R o search 99. Serine Threonine
me Insert Design at Painter 278 words Calibri Layout 11.5A A Aa BIU-abe X₂ X² A--A- ype here to search Font W Unique Unigriffin DNA: mRNA: amino acids: traits: DNA: mRNA: amino acids: traits: DNA: mRNA: amino acids: traits: References # M 3 How DNA Determines Traits- Transcription and Translation Fill in easier type.pptx part 2 - Word Tell me what you want to do... Mailings Review View A-6-5- LLI Paragraph | CAG TCG TTT | ATG GGG CTT CTT TIT | GAG AAT TCA CGC I S4 | CGA CAA CAC | GTA GTA | CAA AAA ATG | TTA TAG AAT GAC GGG TGG | wwwwww O 2 A W R =-- | TTA TTG TTA CGG | AAA AGA CCT | GCA GCC TTG TGT | de in ACROBAT % 5 ¶ T 1 Normal AaBbCcDc AaBbCcl AaBbCcL AaBbCcDc AaBbCcDc AaBbCc[ AaBbCcD Aal 1 Body Text 1 List Para... 1 No Spac... 1 Table Par... Heading 1 1 Heading 2 Hea Styles Y 7 OM O 38°F JACQUI 10 L
Please answer asap and type your answer and do not copy from anywhere please NOTE*** double stranded complementary DNA I have determined is GTCATACCTAGGGTA with a palindromic site of CCTAGG and the enzyme BamHI that will cut the recognition site. In the double-stranded DNA you have determined, there is also another recognition site for common restriction enzymes. Which enzyme would cut your DNA at this other recognition site? (Hint: Remember that one recognition site can overlap with or be completely contained by the sequence containing another recognition site.) HindIII Sau3AI AluI BamHI
Please answer asap and type your answer and do not copy from anywhere please An alien bacteria is found on Mars and is found to contain double stranded DNA. A culture is performed with the bacteria on medium containing radioactive thymine (represented by T*) until all of the thymine in the DNA is radioactive. The culture is then transferred to a medium containing nonradioactive thymine (T). Samples are removed after one round of DNA replication and one portion of double stranded DNA is selected. Two different types of double stranded DNA was identified: Type 1 Type 2 5’ A T*T*T*C G 3’ 5’ A T T T C G 3’ 3’ T*A A A G C 5’ 3’ T A A A G C 5’ What type of replication must be occurring?
דוידודוודי www.www. The above image shows DNA during replication. The new DNA strand build using the top strand as the template would be considered ( Select ] v strand, whereas the new DNA strand build using the bottom strand as the template would be considered ( Select) strand. The lagging strand is synthesized discontinuously and is made up of small fragments called [Select ] v fragments. These fragments contain RNA primers synthesized by [ Select ) ( Select) replaces RNA in the primers with DNA and [ Select ] v glues the fragments together to form a continuous strand. in
elearn.squ.edu.om/mod/qu NG SYSTEM (ACADEMIC) Time left 0:44:39 If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG O b. GGGGGCCCCCAATTCCCCCCC O c. AAAAAATTTTTCCCCCGGGGG O d. TACTACACTGTGGTTAATTAAA O e. ATATATATCGCGTTAAATTCTA CLEAR MY CHOICE Match the given words with the most suitable words from the given list. Unicellular fungi Hyphae Choose..
Oh G A Stocking Stuffers | Artifact Uprising This is the sequence of a piece of DNA. TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT 1st letter Write the amino acid sequence of the protein that would be formed by translating this piece of DNA. You can use the three letter abbreviations for the amino acid in each box, do not use the name of the full amino acids. Use the abbreviation of the amino acid exactly as it is written in the table (including the appropriate capitalizations) For example, if your answer for amino acid 1 is "Methionine" you would write MET in the box (not Met or met) U UUC Phe UCU UCC UUA | UUG U AUU A AUC AUA AUG GUU G GUC GUA GUG Leu CUU CCU C CUC Leu CCC Pro CUA CUG 1st amino acid: UCA UCG lle CCA CCG ACU ACC ACA Met ACG GCU Val GCC GCA GCG Sequence of the protein: C Second Letter A Ser Thr Ala UAU UAC Tyr UAA Stop learn.maricopa.edu CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG 1 UAG Stop UGG Trp G His Gin Lys Asp Asn AGU AGC AGA AGG Glu CGU CGC UGU UGC UGA Stop A CGA CGG G |…
Please answer fast A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is the non-underlined sequence between the exons. TAG, TAA, and TGA are stop codons. 5’-TAGTGTATTGACATGATAGAAGCACTCACTATATTCTGACGTGCGACTATGCGTGGGGTTAGGT ATTGTGCTGACTTTTCTCAGGTGGCCCGTATAGGCTAAGCTGCGCATCGCCGCTAGTCGCTCAGTTCCGC TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3’ 1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3’ to 5’ direction? 3'-____ -5' 2) What are the first five ribonucleotides of the mRNA transcript of this gene ? 5'-____-3' 3) What are the first five ribonucleotides following exon 1 in the mature mRNA transcript? 5'-_____-3' 4) What is the 5' UTR of the mature mRNA transcript in ribonucleotides? 5'-_____-3' 5A) What are the first five ribonucleotides of the 3' UTR? 5'-_____-3' B) What are the last five ribonucleotides of the 3' UTR? 5'-______-3' 6) How many amino acids are…
9 File Content Edit H. E. X erview....pdf View History Bookmarks Profiles Content X PDF Biol 140 X Tab Window Help Begin: 18 X Tutorial X acconline.austincc.edu/ultra/courses/_891351_1/cl/outline Match each of the following with the best answer choice: M. direction template strand is read in K. direction mRNA is synthesized in non-template DNA strand that corresponds to mRNA codons except in DNA code template DNA strand that corresponds to tRNA anticodons except in DNA code primary enzyme responsible for catalyzing transcription transcription initiation site in DNA proteins which aid in the binding of RNA polymerase type of pre-mRNA modification non-coding intervening sequence in mRNA protein coding sequence in mRNA primary cellular structure responsible for translation Unit 3 X protein which binds to A site in the ribosome to end translation type of mutation that results in a premature stop codon type of mutation that results in a different amino acid silent, nonsense, and missense…
Agree or Disagree. Read the statement carefully & write your answer on thespace provided._________ 1. The DNA orders the correct sequence of nucleotides to produce a specific protein._________ 2. DNA is a double stranded molecule while RNA is a single strand molecule.
b bartleby Portal a portal.bartleby.com Apps G Gmail O Youlube Maps Hi reddy venkatesh 5/ 20 25 % > >> 14min 24 secs If a person is homozygous for the presence of an ALU repeat in the PV92 region, you would expect the size of the DNA fragment to be compared to those with no ALU repeats. Larger Smaller same size Cannot be predicted Next by ProProfs Create a Ouiz 1531 OE d ENG 23-09-2021 31°C 1O P Type here to search
Align your two superimposed fragments and look for a repeat