Which step in the processing of heterogeneous nuclear RNA (in eukaryotes), into mature messenger RNA, is required for proper attachment of the small ribosomal subunit to the mature mRNA molecule? polyadenylation at the 3’ end 7-methyl-guanosine capping at the 5’ end excision of introns formation of quadruple-stranded DNA splicing of exons

Which step in the processing of heterogeneous nuclear RNA (in eukaryotes), into mature messenger RNA, is required for proper attachment of the small ribosomal subunit to the mature mRNA molecule? polyadenylation at the 3’ end 7-methyl-guanosine capping at the 5’ end excision of introns formation of quadruple-stranded DNA splicing of exons

Name: Which step in the processing of heterogeneous nuclear RNA (in eukaryot
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which step in the processing of heterogeneous nuclear RNA (in eukaryotes), into mature messenger RNA, is required for proper attachment of the small ribosomal subunit to the mature mRNA molecule?polyadenylation at the 3’ end7-methyl-guanosine capping

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Which of these statements is true about the elongation step of translation? The growing polypeptide chain is transferred from the P site RNA to the A site RNA OThe MRNA moves through the ribosome OThe new amino acid is transferred from the A site tRNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
Arrange the processes involved from Transcription to Translation. RNA polymerase binds in the promoter regions Polypeptide cleavage Release of methionine and conversion to active protein Translocation Appearance of UAG codon Attachment of the mRNA to ribosome with AUG in the P site DNA rejoins Covalent bonding of AA to the tRNA Elongation of RNA transcript Binding of Rho factor Partial unwinding of DNA
Which of these statements is true about the elongation step of translation? The growing polypeptide chain is transferred from the P site RNA to the A site RNA The MRNA moves through the ribosome The new amino acid is transferred from the A site RNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide
EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in prokaryotic translation. The sigma subunit of RNA polymerase is replaced by NusA to recognise the promoter region of a gene. The -10 and -35 sequences in E. coli DNA are referred to as untranslated region. In human, translation begins before transcription of an mRNA completes. this statement true or false.
The processing of ribosomal RNA in eukaryotes is shown . Why is this called cleavage or processing but not splicing?
Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation. One of the processing steps is splicing, where portions of the RNA are removed and the remaining RNA are joined together. Classify the statements regarding mRNA splicing as true or false. True statements False statements In splicing, intron sequences are removed from the mRNA in the form of lariats (loops) and are degraded. Splicing occurs while the mRNA is still in the nucleus. Splicing of mRNA does not involve any proteins. One MRNA can sometimes code for more than one protein by splicing at alternative sites. Splicing occurs while the mRNA is attached to the nucleosome.
What is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG 3’ Answer choices The signal to add a 5’ methyl-guanosine cap to the mRNA sequence recognized by the small ribosomal subunit for translation the signal to add a stretch of adenines to the mRNA Sequence that promotes transcription in eukaryotes the recognition sequence for the sigma factor of the RNA polymerase
Transcription of a typical gene encoding a polypeptide in eukaryotes involves all of the following EXCEPT: transcription of DNA corresponding to both introns and exons. transcription of the DNA corresponding to the gene of the polypeptide which may include UTRS (c) RNA synthesis by RNA polymerase II. the splicing together of a number of exons in the DNA prior to transcription.
A part of an MRNA molecule with the following sequence is being read by a ribosome: 5' - CCG-ACG - 3' (mRNA). The following charged transfer RNA molecules (with their anticodons shown in the 3' to 5' direction) are available. Two of them can correctly match the MRNA so that a dipeptide can form. TRNA Anticodon| Amino Acid GGC Proline Alanine Threonine CGU UGC Glycine Cysteine Alanine СCG ACG CGG The anticodon loop of the first tRNA that will complement this MRNA is Select one: a. 5'-ACG-3' b. 3'-UGC-5' O c. 5'-UGC-3' d. 5'-GGC-3' е. 3'-GGC-5'
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.
MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.