Write the mRNA sequence (5′ to 3′) that would result from transcription of the DNA sequence. (Note: Ignore the colors)
Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first…
A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…
Q: Which of the following sequences is most likely to form a beta-turn? Explain why?…
A: The majority of proteins are globular in form. Thus, forming, turning, bending, or reorienting is…
Q: If a single strand of a gene contains 678 bases, how many amino acids result in the polypeptide…
A: The biochemical substance that is carried from the preceding generation to the succeeding generation…
Q: Given the following stretch of mRNA, what would be the sequence of the corresponding non-template…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of cell.
Q: Identify which mutagen is described by the following statement. Causes alkylation of guanine bases.…
A: Mutagens are the physical or chemical components which causes a permanent change in the genetic…
Q: in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…
A: Transcription is the process that involves the synthesis of an RNA molecule from DNA. It is the…
Q: Complete the tables below to determine the polypeptide chain of a functional and mutated hemoglobin…
A: 1st Six Codons of the Functional Hemoglobin Gene... DNA.. GTG CAC CTG ACT CCT GAG mRNA codon is ..…
Q: What does “Universality and Degeneracy” of the Genetic Code mean? State the significance of both the…
A: The genetic code is said to be nearly universal. It means that a given codon specifies the same…
Q: What are the codons for the variations amino acid?
A: Amino acids are organic compounds that combine to form proteins, which are the building blocks of…
Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…
A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…
Q: If the nonsense mutation is in the last exon of the mRNA, the result would be:
A: Exons are sections of an RNA transcript, that code for a protein. Exons are separated by non-coding…
Q: What would be the effect of an insertion or deletion of one of the bases in a codon?
A: Mutation may be defined as change in single or multiple base pairs resulting in altered phenotype.…
Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second…
A: The mRNA (messenger ribonucleic acid) is synthesized from a DNA (deoxyribonucleic acid) template.…
Q: Why is the term “proteome” ambiguous, whereas the term“genome” is not?
A: The proteins are the essential part of living organisms and it consists of thousands of smaller…
Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…
A:
Q: The codon is found on mRNA? True or False?
A: Codon is a sequence of three consecutive nucleotides in DNA or RNA, that codes for a specific amino…
Q: Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by…
A: Transcription is the process by which the information contained in DNA is converted into a…
Q: If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence…
A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…
Q: Give the ABBREVIATED NAME of the nucleotide in the 5' end." OCH
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: How long is the polypeptide produced from the following mRNA transcript?…
A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…
Q: Which of the following DNA strands, the top or bottom, would serve as a template for RNA…
A: Transcription is the process of making an RNA copy of a gene sequence. This RNA copy is called a…
Q: . What mRNA base sequence would be obtained from the following portion of a gene?
A: Genetic information is transferred from genes to the proteins via messenger RNA.…
Q: Approximately what portion of the human genome is composed of repeat sequences?
A: According to the results found in the human genome studies it is seen that the human genome has…
Q: Assuming the genetic code is a triplet, what effect would the addition or loss of two nucleotides…
A: The process in which the messenger ribonucleic acid (mRNA) molecule sequence is translated to form…
Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…
A: A DNA molecule is a double-helical structure.
Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom…
A: The process of protein synthesis using the information in an organism's DNA is called central dogma…
Q: Using the mRNA codon table below and your knowledge of transcription and translation, complete this…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: What codons are used and with what frequency?
A: mRNA is translated to form proteins. mRNAs contain trinucleotides sequences that are called codons.…
Q: The genetic code uses combinations of 3 RNA bases as letters, each triplet specifies only one amino…
A: A genetic code is a triplet code of nucleotides that codes for a specific amino acid. It is also…
Q: How many introns are present on a gene that consists of 2 exons?
A: Introns and exons are nucleotide sequences in a gene. Introns can be considered as intervening…
Q: Which of the following are elongation factors involved in the attachment of new aminoacyl-tRNAs?…
A: During translation protein synthesis occurs from RNA. The sequence of nucleotides in RNA act as code…
Q: How can you identify the start codon in the mRNA sequence ?
A: mRNA sequence During the process of translation, mRNA is read on the basis of genetic code that…
Q: What could be the effect of a deletion, substitution or addition that alters the sequence of the…
A: Stop codon is a nucleotide triplet which is present in mRNA. This is also known as termination…
Q: What amino acid sequence will be generated, based on the following DNA codon sequence? Did you read…
A:
Q: - Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: mRNA contains coding regions (exons) and non-coding regions (introns). The introns are removed by…
Q: How many codons are there in the mutated DNA-(b) and DNA-(c)? What types of mutations occurred in…
A: Codon is sequences of three DNA or RNA nucleotides.
Q: Which of the following are elongation factors involved in the release of free tRNAs? a.EF-G…
A: The above mentioned elongation factors are involved in the process of translation in prokaryotes.…
Q: What happens when one nucleotide pair is lost from themiddle of the coding sequence of a gene?
A: Gene is a stretch of DNA that codes for a particular polypeptide chain.
Q: Name the three non-sense codons?
A: The genetic material is known to carry the information that is translated and read as triplet code,…
Q: Which of these choices represents one possible corresponding mRNA sequence that can be transcribed…
A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…
Q: Which CODON is the Start one?
A: 20. Translation of mRNA always begins with the start codon AUG which codes for methionine.…
Q: If methionine is always the first amino acid incorporated into an oligopeptide, what oligopeptide is…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: Name the two initiating codons?
A: From the central dogma concept, we knew there is an intricate connection between genes and synthesis…
Q: Which of the following mutations in the protein-coding region of a gene is more likely to lead to…
A: A frameshift mutation is a type of gene mutation in which the insertion or deletion of one or more…
Q: What amino acid is coded by the original sequence (GTA) if the sequence refers to the template…
A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’, what is the sequence of the…
A: EXPLANATION: DNA utilizes four bases, adenine (A), guanine (G), cytosine (C), and thymine (T), in…
Q: If the gene undergoing protein synthesis consists of 24 bases, how many codons does that result in?…
A: In genetic code a unit known as codon, which codes for amino acid. For example the sequence AUG is a…
Q: A codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense…
A: The proteins are the fundamental biomolecules in the body and act as substrates, enzymes, and…
Q: The human genome contains thousands of sequences known as small open reading frames, some of which…
A: Deoxyribonucleic acid (DNA) is a genetic material and it carries genetic information from one cell…
Q: Put the following steps of transcription in order
A: The Central Dogma Theory is one of the most important concepts in the field of Cell Biology. It…
Write the mRNA sequence (5′ to 3′) that would result from transcription of the DNA sequence. (Note: Ignore the colors)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Second letter C A UUU Phenyl- UUC alanine UCU UCC UAU UAC UGU UGC Tyrosine Cysteine Serine UCA UCG UAA Stop codon UAG Stop codon UGA Stop codon UGG Tryptophan UUA A Leucine UUG CCU ССС CAU CAC CUU CGU CGC Histidine C CUC C CUA Leucine Proline Arginine CCA СCG CGA CGG A CAA CAG CUG Glutamine AGU AGC AUU AAU ААС ACU Asparagine Serine AUC Isoleucine A AUA ACC АСА Threonine AAA AGA Methionine; start codon ACG Lysine Arginine AUG AAG AGG U GUU GUC GUA GCU GCC GCA GAU Aspartic GAC acid GGU GGC GGA GGG Valine Alanine Glycine GAA Glutamic GAG acid GUG GCG G Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense mutation? A transversion of A to U Change of nucleotide in the third position Change of nucleotide in the first position A transition of A to G Change of nucleotide in the second position First letter Third letterUsing the following sequence and the amino acid chart, please give the amino acid sequence: 5'-UCAGAUGGGAAGCUUGAUCUUGUGA-3'. Abreviations for the amino acids are accepted. Second Position U A G UGU Cys UUU Phe UUC UCU UCC UCA UCG UAU ]Tyr UAC UGC UGA Stop UGG Trp Ser UUA Levu UUG UAA Stop UAG Stop CUU CỤC CUA CUG CU CC ССА CCG CAU His CAC CGU CGC CGA CGG Leu Pro Arg CAA CAG Gln AUU AUC le AUA AUG Met ACU AAU AAC AAA AAG AGU Ser AGC AGA Arg JAsn ACC The АCА Jlys ACG AGG GCU GGU GGC Gly GUU GAU JAsp GAC GUC Val GUA GCC Ala GCA GAA GGA GGG- GCG- GAG JGlu GUG Third Position (3' end) First Position (5' end)AUU Isoleucine ACU AAU Asparagine AGU Serine U AUC Ile ACC |Threonine AAC AAA AAG Asn AGC Ser |AUA Methionine Lysine Lys AGA Arginine Arg ACA Thr A Met ACG AGG AUG Initiation codon GAU Aspartic acid GAC GCU GCC Alanine GCA GCG GUU GGU GỤC Asp GGC Glycine C G |GUA GUG Valine Val GAA Glutamic acid GAG Ala GGA Gly A Glu GGG G (a) What amino acid will a tRNA be carrying if its anticodon is GGG? Enter its 3-letter code. (b) What amino acid will a tRNA be carrying if its anticodon is UCC? Enter its 3-letter code. (c) What amino acid will a tRNA be carrying if its anticodon is UAU? Enter its 3-letter code. First letter ( Third letter
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…Genetic Code-Reference Second Letter First Letter C Third Letter UAU] UACS **UAA Stop UGU] Cys UGC U UUU Phe UUC UCU Туг UCC U Ser UUA) Leu UUG **UGA Stop UGG Trp UCA UCG **UAG Stop CUU CCU CAU) CGU His CACJ CAA) CUC CCC CGC Leu Pro Arg CUA ССА CGA A Gln CUG CCG CAGJ CGG AAU] AGUSer U AUU ACU AACAsn AAA Lys AUC Ile ACC AGC C Thr AGA] Arg AUA ACА AAGJLYS GAU] GACASP *AUG Met/Start ACG AGG U GUU GCU GGU Asp GUC GCC GGC Val Ala Gly GAA) Glu GAGJ GUA GCA GGA GUG GCG GGG
- 1. The UAU and UAC codons in MRNA both specify What feature of the genetic code explains this? Second letter C UUU Phenyl- UUC alanine UAU UAC UCU Tyrosine UGU UGC Cysteine UCC Serine UCA UUA UUG UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan Leucine UCG CAU CÁC CUU CUC CUA CUG CGU CGC CCU CC CCA CCG Histidine Leucine CGA Arginine CGG Proline CAA CAG Glutamine AUU AUC Isoleucine A AUA AAU AAC Asparagine AGU ACU ACC ACA ACG AGC Serine Threonine AAA Methionine; start codon AGA AGG Arginine AUG AAG Lysine GUU GUC GAU Aspartic GAC acid GCU G GUA GUG GCC Alanine GCA GGA Glycine GGG GGU GGC Valine GCG GAA Glutamic GAG acid Chp 米 144 Third letter UCAG UCAGUCAGU CAG First letterIdentify the correct name or abbreviation for the given nucleoside or nucleotide. guanosine ADP dADP dGDP GDP Identify the correct name or abbreviation for the given nucleoside or nucleotide. GDP dADP ADP O deoxyadenosine dGDP OMP O || -O-P-O-P-O. fot O™ tt -O-P-O- O™ ܘ ܐ ܘ ܐ OIPIO N OH OH OH N H₂N N ΝΗ N NH₂If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letter
- Oh G A Stocking Stuffers | Artifact Uprising This is the sequence of a piece of DNA. TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT 1st letter Write the amino acid sequence of the protein that would be formed by translating this piece of DNA. You can use the three letter abbreviations for the amino acid in each box, do not use the name of the full amino acids. Use the abbreviation of the amino acid exactly as it is written in the table (including the appropriate capitalizations) For example, if your answer for amino acid 1 is "Methionine" you would write MET in the box (not Met or met) U UUC Phe UCU UCC UUA | UUG U AUU A AUC AUA AUG GUU G GUC GUA GUG Leu CUU CCU C CUC Leu CCC Pro CUA CUG 1st amino acid: UCA UCG lle CCA CCG ACU ACC ACA Met ACG GCU Val GCC GCA GCG Sequence of the protein: C Second Letter A Ser Thr Ala UAU UAC Tyr UAA Stop learn.maricopa.edu CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG 1 UAG Stop UGG Trp G His Gin Lys Asp Asn AGU AGC AGA AGG Glu CGU CGC UGU UGC UGA Stop A CGA CGG G |…RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…First letter U U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine A AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine Normal, wild-type sequence A. mutation I mutation A UCU UCC mutation C UCA UCG mutation B CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC B. mutation II C. mutation III Point mutations are underlined. GCA GCG C Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC A CAA CAG Histidine Glutamine AAU AAC Asparagine AAA AAG Lysine GAU Aspartic GAC acid GAA Glutamic GAG acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC GGU GGC AGA AGG Arginine GGA GGG AUG UCU CGG GCU UAC AUA UCU CGG GCU UAC AUG UUU CGG GCU UAC AUG UCU AGG GCU UAC Arginine Serine Glycine Which mutation could result in the removal of a site for glycosylation or phosphorylation? DOAGUO AGUO AGUAG Third letter с