Q: QUESTION 4 Which of the following statements about Chagas' Disease is NOT true? Acute disease is…
A: Chagas Disease It is a disease caused by the infection with the protozoan parasite Trypanosoma…
Q: 4 The complete genome of the simplest bacterium known, Mycoplasma genitalium, is a circular DNA…
A: Introduction-- Dna topoisomerase enzyme act to regulate Dna supercoiling by catalyzing the winding…
Q: What for lamb bones change the most and the least?
A: Explanation: This is due to the fact that the bones that are utilized more frequently are subjected…
Q: Step 1: Depict E + S • Draw an enzyme and one substrate. Show and label the substrate binding site…
A: Enzyme It is a protein molecules which is used in a biological reactions and lower down the…
Q: Download BLOSUM30 and BLOSUMB0 substitu- tion matrices and place them side by side on your computer…
A: BLOSUM matrix: It stands for "blocks substitution matrix," established by Henikoff and Henikoff,…
Q: The smooth endoplasmic reticulum is responsible for a) bringing substances into the cell. b) fusing…
A: The endoplasmic reticulum (ER) is a large, dynamic structure in the cell that performs numerous…
Q: 6. Complete the following table: SOLUTE NaCl Urea CaCl₂ CaCl₂ MOLARITY (mole/L) 3 0.2 OSMOLARITY…
A: In healthcare settings and biology labs, it’s frequently useful to consider how answers will have an…
Q: What molecule forms when Acetyl-CoA enters the Krebs cycle? ATP pyruvic acid…
A: Krebs cycle also known as citric acid cycle was discovered by Sir Hans krebs in the year 1937. In…
Q: Explain the hydraulic limitation hypothesis and what it says about tree height.
A: The word "hydraulic" relates to the "movement of liquid". Hydraulic Limitation Hypothesis is a…
Q: What is Chorioallantoic Membrane?
A: Developmental biology studies how integrating systems produce an organism's diverse dimensions,…
Q: A false positive is a a test result that indicates that a person has a specific disease or condition…
A: Blood pressure is the pressure of circulating blood against the walls of blood vessels. It is…
Q: [ Dragonflies Crickets Cockroaches Ants Beetles Moths Flies Which of the following statements is…
A: A tool for displaying the evolutionary relationship is a phylogenetic tree. The premise of the…
Q: Two pea plants, each genotype TT, Tt Knowing that the allele of tall leg is T, allele short leg is…
A: Given Allele T - for tall t - for short T - dominant t - recessive Parent genotype and…
Q: why does DNA breathing occur?
A: Introduction: DNA serves as the template and substrate for many important biological processes,…
Q: Where would you expect competitive exclusion to occur most quickly? (Choose the one best answer.)…
A:
Q: The incoming vesicle is responsible for O a) bringing substances into the cell b) synthesizing…
A: Vesicles are small cell organelles that are present in cells. These organelles are small,…
Q: Clearly draw the Punnett Square Hemophilia is a rare blood disorder in humans that makes the blood…
A: Punnett Square is a tool for the visual representation of a cross between two individuals. The table…
Q: Which of the following is a synapomorphy for mammals? a)Lactation b)Limbs c)Circulatory system…
A: Evolution is defined as a slow gradual change over a period of time. It brings about the…
Q: Which of the following statements is true about linkage disequilibrium?
A: LD or linkage disequilibrium is the non-random association of alleles from different loci. LE or…
Q: 5. Graph the activity of enzyme 2, label your axes, and then answer questions 6-10. substrat e conc.…
A: The ans from 6 to 10 can't be given as the graph one is missing. So the graph of enzyme 2 only can…
Q: How does the streaking of plates help you obtain single colonies?
A: Microbial cultures can be grown in solid or liquid media. The solid media use a solidifying agent…
Q: WHICH IS THE BASE AT OFFSET 5 OF GATTACA. LEFTMOST BASE HAS OFFSET 0.
A: Base offset is an addressing scheme that allows the CPU or any other man or machine to start…
Q: Describe the two events that are common to all sexually reproducing organisms and how they fit into…
A: Introduction: The union of male and female gametes leads to sexual reproduction. More viable…
Q: ANSWER THE QUESTION PROPERLY Question : Assuming you encountered an unknown microorganism, attempt…
A: Identification of any unknown microorganisms requires a pipeline of different molecular and…
Q: qualitative thinking: For diffusion, we need to keep straight the difference between diffusion rate…
A: Diffusion The movement of molecules across cell membrane or cell wall according to the concentration…
Q: 1. What is the overall charge on the side chain of lysine when one third (33%) of the side chains…
A: Lysine It is a amino acid which is used in making many type of protein.
Q: B-lymphocytes convert into plasma cells, before they produce antibodies. Which of the following…
A: phagocytes, a type of living cell, devour or engulf other cells or particles through a process known…
Q: Which of the following amino acids has UV absorbance of 280 nm? a. Ser b. His…
A: Introduction :- The complete spectrum of ultraviolet light, which is typically split into UV-A,…
Q: This member of class Alphaproteobacteria has a unique method of moving around and orienting itself…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: The factor deficient plasma used in a factor assay
A: The blood test for measure the activity of factor VIII is called factor assay. Factor VIII is one…
Q: DNA: What supercoiling is, how and why it occurs, and the differences between positive and negative…
A: Introduction Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…
Q: Distinguish among directional, stabilizing, and disruptive selection.
A: With the introduction of the theory of natural selection (explained the concept of evolution of many…
Q: "The cuticle and its profound effect on the organisation and functioning of the insect body".…
A: Introduction : Insects belong to the class Hexapoda, or Insecta, which is the biggest division of…
Q: The following are the conditions that determines the direction of ions as it pass through the…
A: Introduction : A membrane that permits certain molecules to pass through it but not others is said…
Q: Why are viruses not grouped into any of the six kingdo They are not capable of independent metabolic…
A: Virus is an infective agent that typically consists of a nucleic acid molecule in a protein coat, is…
Q: Initiation. Promotion Progression/ Angiogenesis, tumor migtation Cells multiply uncontrollably DNA…
A: Cancer is defined as rapid non-controllable cell division triggered by either external (UV or…
Q: How is the DNA unwound at the replication fork? What effect does this have on the DNA upstream of…
A: DNA It is a double stranded helical structure present in almost all eukaryotic cell.
Q: Thyroid hormone is produced within spherical shape structures in the thyroid gland known as 3. 1_ _…
A: Thyroid gland A crucial hormone gland It is important for the growth, development, & metabolism…
Q: Why do trees grow and stop at different heights
A: The tree height is defined as the length of the tree starting from its base to the tip of its…
Q: what is bone marrow as an hematopoietic organ
A: Mesenchymal and hematopoietic stem cells are found in bone marrow. Red bone marrow is a fragile,…
Q: Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of…
A: Gene is a hereditary unit which helps in transfer of genetic information. Genetic information is…
Q: A paramecium (ciliated protozoan) ingests a poison, the poison inhibits the function of its…
A: Paramecium The slipper like protozo having cillia all arround the cell wall.
Q: Natural selection (a) leads to species being better adapted to their environment. (b) may lead to…
A: Introduction: Evolution is governed by four principles: variation, inheritance, selection, and time.…
Q: Which of the following are TRUE statements? Select all that apply The unfolding of a protein by heat…
A: INTRODUCTION Protein Proteins are biomolecules composed of amino acids.
Q: Complete the sentence using one of the choices: A gene is a region of DNA that contains triplet…
A: DNA: Deoxyribonucleic acid (DNA) is a polymer made of two polynucleotide chains that coil around…
Q: Due to climate change, food security is highly compromised. Sequentially explain recombinant DNA…
A: Introduction : The use of technology to alter or manipulate a biological system for human advantage…
Q: Coral polyps and their symbiont zooxanthallae algae are an example of..... competition O facultative…
A: .Ecological relationships describe the interactions between and among organisms within their…
Q: Need help, please. Please answer the following four questions to the image I attached. 1. You…
A: The restriction enzymes are specific endonuclease that are responsible for cutting double stranded…
Q: How does translation work? mRNA attaches to a The ribosome lines up complementary molecules. Their…
A: Protein synthesis is a process which occurs after transcription is completed. Transcription is a…
Q: Energy is required to transport molecules a) dissolved gases needed for respiration. b) against the…
A: Transportation is an essential, natural, and physiological action that occurs in all higher species,…
Step by step
Solved in 2 steps
- A researcher sequences a DNA fragment using dye-terminator sequencing. In this procedure, each dideoxynucleotide triphosphate (ddNTP) contains a fluorescent marker specific to the base. Upon excitement by a laser, the ddNTPs emit light at their characteristic wavelengths. An automated machine then reads the sequence. In this procedure, • ddCTP is tagged with a blue marker that emits light at 517 nm, • ddATP is tagged with a green marker that emits light at 540 nm, • ddGTP is tagged with a yellow marker that emits light at 570 nm, and ddTTP is tagged with a red marker that emits light at 635 nm. The primer has the sequence 5'-ATGAC-3'. In the image shown here, the shortest fragments are at the bottom and the longest fragments are at the top. с G с T A T T T T T с G G Write the nucleotide sequence of the newly synthesized DNA, without the primer, in the 3'to 5' direction. 31- 5A DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide LengthThe chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'
- Both protein and DNA are run together in an isoelectric focusing (IEF) electrophoresis using the immobilised pH gradient (IPG) strip with pH range of 4-7. After the electrophoresis and staining, only ONE band is observed on the middle of the IPG strip. The band is a protein band. Briefly explain why only the protein band and NOT the DNA band appear on the IPG strip.A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment, and set up a series of four dideoxy reaction. You then separate the products of the reaction by gel electrophoresis and obtain the following banding patter: ddATP ddTTP ddCTP ddGTP What is the base sequence of the original fragment that you were given? 5'-TAAGCTGA-3' O 5'-ATTCGACT-3' O 5'-TCAGCTTA-3' O 5'-AGTCGAAT-3'consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. if the given DNA sample was subjected to ion-torrent sequencing, sketch the expected profile of the sequencing output. assume that the sequential flooding of nucleotides follows the order G-C-A-T.
- A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment, and set up a series of four dideoxy reaction. You then separate the products of the reaction by gel electrophoresis and obtain the following banding patter: ddATP ddTTP O 5'-ATTCGACT-3' O 5'-TCAGCTTA-3' What is the base sequence of the synthesized fragment? O 5'-AGTCGAAT-3' ddCTP O 5'-TAAGCTGA-3' I ddGTPWhat is the role of GelRed® in Agarose gel electrophoresis of DNA fragments? GelRed® moves down the agarose gel in response to the electric current and enables visualisation of the position of the nucleic acids within in the agarose gel. GelRed® intercalates with the Nucleic acid and, under UV light, fluoresces to enable visualisation of the position of the nucleic acids in the agarose gel. GelRed® intercalates with the Nucleic acid and enables visualisation of the position of the nucleic acids in the agarose gel. GelRed® intercalates with the amino acids in the agarose gel and enables visualisation of the position of their in the agarose gel.This piece of DNA is cut by EcoRI, the resulting fragments are separated by gel electrophoresis, and the gel is stained with ethidium bromide. Draw a picture of the bands that will appear on the gel.
- During agarose gel electrophoresis, why does DNA move through the gel when electric current is applied? because DNA is negatively charged because a charged chemical from the loading buffer is bound to the DNA because DNA is positively charged because DNA absorbs electricityA geneticist is interested in determining the locations of methylated cytosines within a fragment of DNA. She treats some copies of the fragment with sodium bisulfite and leaves some copies untreated. She then sequences the treated and untreated copies of the fragment and obtains the following results. Give the original sequence of the DNA fragment and indicate the locations of methylated cytosines. Sequence without treatment: — AATTGCCCGATCGATTAAGCCA — Sequence with treatment: — AATTGTTTGATCGATTAAGCTA —Explain why DNA fragments migrate in a gel electrophoresis. Which fragments migrate farthest: large or small?