Answered: YFP-SC35 encodes a splicing factor. You…

Name: YFP-SC35 encodes a splicing factor. You would expect this molecule to
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: YFP-SC35 encodes a splicing factor. You would expect this molecule to be localized in what compartment of the cell? nucleoli nucleus cytoplasm mitochondria

Science

Biology

YFP-SC35 encodes a splicing factor. You would expect this molecule to be localized in what compartment of the cell? nucleoli nucleus cytoplasm mitochondria

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 18RQ: IS. Alternative splicing has been estimated to occur in more than 95% of multi-exon genes. Which of...

See similar textbooks

Similar questions

Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To generate the YFP, you know the pre-MRNA looks as follows: Unspliced YFP premature mRNA Сap 5' UTR Exon 1 Intron Exon 2 Intron Exon 3 3' UTR Poly-A tail If Exon 2 is also required for mRNA stability, what can be predicted from the possible spliced alternative isoforms formed? One of the isoforms will not have a poly-A tail O The alternative splicing of YFP pre-MRNA prevents 5'-capping The MRNA isoform without Exon 2 will be degraded faster than the other isoform Exon 2 will be added to isoform B later to correct the mistake in splicing The protein translated from one of the mRNA isoforms will possess an additional functional domain
IS. Alternative splicing has been estimated to occur in more than 95% of multi-exon genes. Which of the following is not an evolutionary advantage of alternative splicing? Alternative splicing increases diversity without increasing genome size Different gene isoforms can be expressed in different tissues Alternative splicing creates shorter mRNA transcripts Different gene isoforms can be expressed during different stages of development.
Gene X codes for a protein in eukaryotes. A mutated eukaryotic cell contains an altered base-pair in an intron of gene X. Which would be the most likely effect of this mutation on the biomolecules in the cell? The amount of pre-mRNA transcribed from gene X would be less than normal. The amount of functional protein corresponding to gene X would be less than normal. The ability of snRNAs to form a spliceosome would be diminished. The breakdown of mature mRNA corresponding to gene X would be faster
Describe the structure and function of a spliceosome. Speculate why the spliceosome subunits contain snRNA. In other words, what do you think is/are the functional role(s) of snRNA during splicing?
Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins,they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteinsenter the nucleus from the cytoplasm? Can you also include a representation of relevant proteins and proteindomains to explain how these proteins reach their destination. Thank you
A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. Which amino acids in the protein should be used to construct the probes so that the least degeneracy results?
Splicing machinery must recognize three portions of the precursor RNA molecule: the 5’ splice site, the 3’ splice site, and the exon junction complex (EJC). True or false
A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. How many different probes must be synthesized to be certain that you will find the cDNA sequence that specifies the protein?
Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…
ATM is a kinase that phosphorylates histone H2AX in response to double-stranded DNA breaks. Which of the following scenarios would most quickly regulate ATM activity in the cell? a) Adding silencing methyl groups to cytosines in the Atm gene b) Modifying the histone code for the Atm gene c) Increasing expression of a miRNA specific for the Atm mRNA d) Activating an E3 ubiquitin ligase specific for the ATM protein
Why is the ErbB family pathway an important pathway for researchers that target cancer therapy. explain in 3-5 sentences.
Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'