You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate this complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with its major regions, such as the promoter regions, where the RNA polymerase Il and transcription factors would bind etc. Having drawn this figure, use it to answer questions #6, 7 & 8: From the list given - choose all components that you thìnk are part of a typical eukaryotic gene O S'UTR O enhancer exons DNA-bending protein O mediator protein introns 3'UTR core promoter O PPE coding sequence

You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate this complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with its major regions, such as the promoter regions, where the RNA polymerase Il and transcription factors would bind etc. Having drawn this figure, use it to answer questions #6, 7 & 8: From the list given - choose all components that you thìnk are part of a typical eukaryotic gene O S'UTR O enhancer exons DNA-bending protein O mediator protein introns 3'UTR core promoter O PPE coding sequence

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 21QP: Transcriptional regulators are proteins that bind to promoters (the 5-flanking regions of genes) to...

See similar textbooks

Similar questions

You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate this complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with its major regions, such as the promoter regions, where the RNA polymerase II and transcription factors would bind etc…. I need the correct answer please From the list given - choose all components that you think are part of a typical eukaryotic gene
Genes can be transcribed into mRNA, in the case of protein coding genes, or into RNA, in the case of genes such as those that encode ribosomal or transfer RNAs. Define a gene. For the following characteristics, state whether they apply to (a) continuous, (b) simple, or (c) complex transcription units.i. Found in eukaryotesii. Contain intronsiii. Capable of making only a single protein from a given gene
Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins,they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteinsenter the nucleus from the cytoplasm? Can you also include a representation of relevant proteins and proteindomains to explain how these proteins reach their destination. Thank you
The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?
What event in eukaryotes serves as the "trigger" for entering the elongation phase of transcription by RNA polymerase lH? O the formation of the first phosphodiester bond of the transcript, assisted by TFIIH and TFIIE (5) acetylation of the tails of histones H3 and H4 the activation of the phosphatase by TFIIF phosphorylation of the CTD of RNA pol II by the kinase of TFIIH O the leaving of sigma from the promoter
The interphase nucleus is a highly structured organelle with chromosome territories, interchromatin compartments, and transcription factories. In cultured human cells, researchers have identified approximately 8000 transcription factories per cell, each containing an average of eight tightly associated RNAP II molecules actively transcribing RNA. If each RNAP II molecule is transcribing a different gene, how might such a transcription factory appear? Provide a simple diagram that shows eight different genes being transcribed in a transcription factory and include the promoters, structural genes, and nascent transcripts in your presentation.
Ignoring transcriptional methods, name two other "levels" aka methods a cell can use to ultimately control gene expression. Remember you are going to avoid mentioning things that affect transcription levels.
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices 1.Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds. 2.Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. 3.Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. 4.Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination.
The following logo plot represents the preferred cis-regulatory sequences (i.e. transcription factor binding site) of bHLH transcription factor FOSL1. C 1 2 3 4 5 6 7 8 9 10 11 position Would you expect this sequence to be recognized by a monomer, a homodimer, or a heterodimer of the protein? Explain your answer. (short phrases are sufficient; please write your answer into the template below) A- В I A -l expect FOSL1 to bind as a: (monomer, homodimer, heterodimer; please choose) B - short explanation: information content (bit) !!
A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT Group of answer choices 1.The mutation would inhibit the promoter thereby inhibiting transcription 2.No change the consensus TATAAT sequence in the same. 3.The mutation would move the promoter away from consensus and reduce the level of transcription 4.The mutation would bind the promoter to the consensus and produce normal levels of transcription
5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…
Transcriptional regulators are proteins that bind to promoters (the 5-flanking regions of genes) to regulate their transcription. Assume that a particular transcription regulator normally promotes transcription of gene X, a transport protein. If a mutation makes this regulator gene nonfunctional, would the resulting phenotype be similar to a mutation in gene X itself? Why or why not?