You implant a sample material subcutaneously in the back of a rabbit model in an effort to evaluate the tissue response. After 24 hours, you notice the pres- ence of an infection in one of the hind legs. Is this infection due to the presence of the implanted material?
Q: . If you observed a dicentric bridge at meiosis, what rearrangement would you predict had taken…
A: Introduction :- Only if there was at least one crossover in the inverted segment would a bridge…
Q: Explain the process of DNA replication.
A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…
Q: have seen that energy is essential for life on earth. All organisms need energy to maintain their…
A: Green plants are the producers as the prepare food for all the living Kingdom. Heterotrophs are…
Q: Identify one technology which would cause a significant reduction in the primary pollutants…
A: Introduction - Pollution from automobiles, power stations, industrial boilers, refineries, and…
Q: Question 1 In E. coli, the leading strand is synthesized discontinuously while the lagging strand is…
A: Replication of DNA It is the process through which a double-stranded DNA molecule is copied to form…
Q: Describe the trait that distinguishes chytrids
A: A fungus is a type of eukaryotic creature which comprises microorganisms like yeasts and moulds,…
Q: A new recessive mutant allele doesn’t show pseudodominance with any of the deletions that span…
A: Pseudodominance is defined as the sudden appearance of the phenotype of a recessive gene in a…
Q: (b) How is ATP converted to ADP by glucose? Explain. Why is there no intake of phosphoric acid by…
A: ATP is converted into glucose by cellular respiration. Glucose is completely oxidised into carbon di…
Q: Why is Trisomy 21 more common than other trisomies (e.g. Trisomy 1, Trisomy 2, etc.)? The size of…
A: Answer :-(C) Trisomy 21 are caused by nondisjunction, which occurs when pairs of homologous…
Q: iscu
A: Answer- Human sexuality is the way people experience and express themselves sexually.Biological,…
Q: ) With the indication of sense strand, template strand, the direction of transcription, provide a…
A: the direction of the DNA template strand for transcription is Strand elongation DNA is…
Q: 1. The enzyme that fills the gaps between the Okazaki fragments is ________. a.DNA polymerase…
A: Introduction DNA, or deoxyribonucleic acid, is the carrier of genetic information from generation to…
Q: The somatic cells of a given species contain 14 pairs of chromosomes. If a gamete receives one…
A: Somatic cells contain 2n number of chromosomes (diploid) and gametes contain n number of chromosomes…
Q: Question 9 The mechanism for all template-directed synthesis of any type of nucleic acid involves…
A: Template strand The template strand is the strand of DNA which replicate itself during the process…
Q: Which of the following does NOT tend to promote genetic divergence between populations? a)…
A: The genetic diversity has three different sources: mutation, recombination and immigration of genes.
Q: what is bacillus megaterium? must be in essay form.
A: Microbes are minute living creatures that must be identified with specialized scientific equipment…
Q: Name the four classes of bones? a) Long, short, regular, irregular b) Big, small, flat, bulged c)…
A: Our body' structure is provided by bones. There are 206 bones in the mature human skeleton. The…
Q: How do plants protect themselves from foreign bodies
A: There are defense mechanism in plants to protect themselves from the foreign bodies. Plants release…
Q: Match the description on the left side to the correct term from the choices on the right side.…
A: 51. --> option M. 52. --> option B. 53. --> option L. 54. --> option J and K…
Q: What is Pepsin
A: Digestion of food begins inside the mouth with the help of the enzyme salivary amylase and digestion…
Q: Why is colour blindness more prominent in males than females?
A: Introduction In this question we will discuss why colour blindness is more prominent in males than…
Q: Describe the steps of transcription in bacteria
A: Introduction - In the nucleus, transcription occurs. To make an RNA (mRNA) molecule, it uses DNA as…
Q: Discuss the environmental consequences of biomaterials compared to non-biomaterials.
A: A biomaterial is a substance that has been developed to interact with biological systems for…
Q: (i) What type of transmembrane protein is it? || (ii) Does it have an N-terminal peak above 2 on a…
A: Membrane proteins are responsible for most of the dynamic process carried out by membranes. Most…
Q: Q4 - What are two features of your protein's (Phosphoenolpyruvate carboxykinase, PCK1) structure…
A: Answer-4 A protein is a normally occurring, extremely complex substance that consists of amino acid…
Q: Explain why the genetic code is redundant
A: Introduction :- The genetic code is made up of codons, which are three-letter nucleotide pairings…
Q: 9. What slide preparation technique should you use for the following research goals? Briefly justify…
A: Answer :- a) Maceration technique In maceration the complex substance is broken down into simple…
Q: Creation and presence of variation are directionless, but natural selection is directional as it is…
A: Introduction In this question we will comment on the statement given in the question.
Q: Question 22 During RNA chain elongation gyrase proceeds ahead of the transcription bubble in order…
A: DNA gyrase does the indispensable job of catalyzing the ATP dependent negative supercoiling of…
Q: Electrical impulses travelling from a point of origin to adjacent regions of the cortex is referred…
A: A sudden uncontrollable electrical disturbance on the brain is known as seizure. Causes change in…
Q: 1. The group of Leonor and Junior conducted an experiment about the fragmentation of planaria.…
A: In this, the given paragraph includes the experimental process and the observations of…
Q: Question 43 The DNA strand that serves as a template during transcription is known (other than…
A: DNA transcription is the process by which the coded information from the genome is sent to the cell…
Q: Mention two effects that phosphorylation of the CTD tail of RNA polymerase II has on the…
A: The CTD is expanded as a C-terminal repeat domain. It is a type of unusual extension that has a…
Q: Diagram a translocation arising from repetitive DNA.Repeat for a deletion.
A: Changes in the structure of chromosomes may create issues with the body's systems' development,…
Q: How would you make a monoploid plantlet by startingwith a diploid plant?
A: Monoploid plants have a single pair of chromosomes in each cell, whereas diploid plants contain a…
Q: Adaptive radiation is when populations diverge from a common ancestor into new species, each of…
A: Adaptive radiation/ convergence is a phenomenon in which populations can undergo two processes:-…
Q: Phosphofructokinase (PFK) catalyzes a key step in glycolysis. This enzyme is composed of three…
A: The most common causes of anemia in the elderly are chronic disease and iron deficiency. Vitamin B12…
Q: What is the relationship between the severity of symptoms and the size of the chromosome involved in…
A: More the size of the chromosomes involved in the trisomy, more will be the severity of symptoms.…
Q: Within an ecosystem, the total amount of energy produced initially by primary producers will be the…
A: Answer :- Option (A) is correct. - More than.
Q: 12. Draw one labeled graph with two myograms: a single twitch contraction for a Type 1 fiber, and…
A: The skeletal muscle fibers can be differentiated primarily based on how speedy they can go through…
Q: TACTGCCTCCCCATAAGAATT
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: 1. Infections caused may fall into one of four categories which vary depending on the site affected…
A: Infections It is defined as the invasion of organism's body cells by disease causing pathogens.…
Q: Describe the growth and reproduction of a zygote fungus
A: A fungus is a type of eukaryotic creature which comprises microorganisms like yeasts and moulds,…
Q: Is meticillin-resistant Staphylococcus hospital-acquired infection? aureus (MRSA) the only major
A: Introduction - Staphylococcus aureus is a Gram-positive, round-shaped bacterium that belongs to the…
Q: Which molecules regulate cross-bridge attachment activity? O a. tropomyosin and M lines O b. calcium…
A: The Muscular System is a vital physiological system that humans require in order to exist. This…
Q: Your uncle has tried every diet under the sun, yet he is still a very large man. He probably has…
A: When a person eats excess food and is not put into use then this food turns into fat reserve which…
Q: Q.2. State the behavioural changes observed in an alcohol addict and remedial measures to overcome…
A: The following modifications have been observed: Because alcoholic beverages are expensive, they…
Q: Which of the following would happen under the constrained physical activity model? O a. Individuals…
A: A state of "physical fitness" can be defined as a condition of well-being. Bodily health is a…
Q: 1.) Time to harvest a crop is often determined by changes that takes place in the economic part of…
A: Harvesting is the process of eliminating whole plants or economically valuable sections once they…
Q: A. Answer the following questions briefly 1. How does the body react to protect itself from…
A: Answer
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Answer the questions bellow by using the diagram provided; 1.a) Identify the structures marked by the unlabelled arrow in spacimen I b) what major type of tissue will you find in this region at the arrow Head?c) Base on your knowledge on basic tissues, describe the tissues located in the top left corner of specimen one 2. Identify the structure/area at the arrow Head in specimen II3. A. In what region of the skin is this structure located in question 4? B. Label the following on the specimen above.i. The eccrine sweat glandii. Hair C. Label the sebaceous gland on the micrograph D. Base on your knowledge on the basic tissue, give the detailed description of the tissue in relation to epithelia, connective and muscles. 4. The area marked by the arrow Head in specimen III is..Besides increased availability, what are twoother potential advantages of laboratorygrownlungs (or other tissues) compared toregular donor tissues?In order to ensure good collagenization, which of the following is true during the proliferation stage of tissue repair? OTwo of the answers are correct A great deal of oxygen is required for fibroblast energy source and as building blocks of collagen O All of the answers are correct O The collagen is initially laid down randomly in the wound, not necessarily along the lines of force the tissue will experience. O Most collagenization occurs by 4-6 days after injury
- Tissue engineering combines living cells with synthetic materials to create functional substitutes for human tissues. What components would you use to engineer a replacement for facial skin? Include an adequately labeled sketch/diagram.Give typing answer with explanation and conclusion Which Th subsets are most associated with chronic inflammatory diseases? Th1 and Th2 cells Th1 and Th17 cells Th2 and Th17 cells Th1 cells only Th2 cells only Th17 cells onlyWhich of the following steps are in the correct order for the inflammatory response? O inflammatory chemicals released, collagen fibers bridge the gap, fully regenerated epithelium results O macrophages phagocytize debris, clotting occurs, fibrosed area matures clotting occurs, fully regenerated epithelium results, inflammatory chemicals are released blood supply restored, inflammatory chemicals are released, fibrosed area matures O none of these are in the correct order
- Idetnify the tissue shown in the imageEnter a tick mark () in the appropriate column to indicate whether the following are properties epithelial, connective, muscle or nervous tissue. You may have multiple tick marks if the statement pertains to more than one of the given choices. Properties 1.Found in the brain and spinal cord 2.Produce blood cells 3. Includes salivary and sweat glands 4.Play a role in phagocytosis 5. Able to contract as a response to Epithelial Connective Muscle Nervous stimuli | 6.Found in ligaments and tendons 7.Lacks blood vessels 8.Has intercalated disc |9. Transmit nerve impulses from one cell to another |10. Includes white and yellow fibersWhy Can inflammation ocaur in any organ in the body? Describe the role of tissue repair in restoring homeostasis. Section integration During inflammation, both blood flow and blood vessel permeability increase in the injured area. Describe how these responses ald the cleanup process and eliminate the inflammatory stimuli in the injured area.