Principles of Biology
2nd Edition
ISBN: 9781259875120
Author: Robert Brooker, Eric P. Widmaier Dr., Linda Graham Dr. Ph.D., Peter Stiling Dr. Ph.D.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10.3, Problem 1CC
Do the ends of protein-encoding genes have a poly T region that provides a template for the synthesis of a poly A tail in mRNA? Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.
For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference.
5' AGUCCGUAC 3'
5' AAUUGCUUC 3'
The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?
Chapter 10 Solutions
Principles of Biology
Ch. 10.1 - What is the direction of flow of genetic...Ch. 10.1 - Prob. 1TYKCh. 10.1 - Prob. 2TYKCh. 10.1 - Prob. 3TYKCh. 10.2 - How would removing a terminator from a gene affect...Ch. 10.2 - Prob. 1BCCh. 10.2 - Prob. 1TYKCh. 10.2 - Prob. 2TYKCh. 10.3 - Do the ends of protein-encoding genes have a poly...Ch. 10.3 - The splicing of pre-mRNA in eukaryotes involves...
Ch. 10.3 - Prob. 2TYKCh. 10.4 - Prob. 1CCCh. 10.4 - Prob. 2CCCh. 10.4 - Prob. 1TYKCh. 10.4 - Prob. 2TYKCh. 10.5 - Prob. 1CCCh. 10.5 - Prob. 1BCCh. 10.5 - Based on the gene sequences shown here, pick two...Ch. 10.5 - Prob. 1TYKCh. 10.5 - Prob. 2TYKCh. 10.5 - Prob. 3TYKCh. 10.6 - Prob. 1CCCh. 10.6 - Prob. 1TYKCh. 10.6 - Prob. 2TYKCh. 10 - Which of the following best represents the central...Ch. 10 - Prob. 2TYCh. 10 - Prob. 3TYCh. 10 - Prob. 4TYCh. 10 - Prob. 5TYCh. 10 - Prob. 6TYCh. 10 - The legion of a tRNA that is complementary to a...Ch. 10 - Prob. 8TYCh. 10 - Prob. 9TYCh. 10 - Prob. 10TYCh. 10 - Lets suppose a gene mutation changed the sixth...Ch. 10 - What is the function of an aminoacyl-tRNA...Ch. 10 - A principle of biology is that the genetic...Ch. 10 - Prob. 1CBQCh. 10 - Prob. 2CBQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given this mRNA strand: 3’ - AUGAGGAAGGUA - 5’; what are the components of the polypeptide?arrow_forwardWhat amino acid sequence does the following mRNA nucleotides sequence specify? 5'- AUGGCCAGCUGU -3' Express the sequence of amino axis's using the three-abbreviations, separate hyphens (e.g., Met-Ser-Thr-Lys-Gly).arrow_forwardGiven the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the stop codon, the untranslated regions and predict the amino acid sequence of the polypeptidarrow_forward
- Although the RBS (Ribosome-Binding Site) sequences vary considerably in different genes, they include examples like GAGGGG that could serve as code for Glu-Gly. Does this imply that the amino acid sequence Glu-Gly can never occur in a protein, lest the two mRNA codons be read as a RBS sequence? Explain your answer.arrow_forwardWhen an intron is undergoing the first step in splicing, where is the first breakage of the phosphodiester backbone that occurs? (Explain)arrow_forwardExplain why the translation of a given mRNA can be inhibited by a segment of its complementary sequence, a so-called antisense RNA.arrow_forward
- A eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP. Where will the radioactive isotope appear in mature mRNA if the ATP is labeled at the (a) α position, (b) β position, and (c) γ position?arrow_forward(a) Write the complementary base sequence for the matching strand in the DNA section shown below:. 5' - ATGTTACTAGT C-3' (b) The following section of DNA is used to build an MRNA for a protein: 3'-AAG-CTT-CTC-5'. What is the corresponding mRNA sequence?arrow_forwardA hypothetical tripeptide Leu-Leu-Leu could be synthesized by the cell. What three different base triplets in mRNA could be combined to code for this tripeptide?arrow_forward
- Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the one-letter abbreviation of the protein product of the mRNA transcript?arrow_forwardOne of the codons in mRNA that specifies the amino acid phenylalanine is UUC. What is the anticodon on the tRNA that carries phenylalanine?arrow_forwardA polypeptide has 51 amino acids in its primary structure. (i) What is the minimum number of DNA bases required to code for the amino acids in this polypeptide. Show your calculation. (ii) Does AUG appear in the first three nucleotides in the mRNA coding for this mRNA? Explain why.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license