1. For each of the sequences given below, list what type of secondary structural element, if any is most likely to be formed by that amino acid sequence. 1a. SEGEWQLVLHVWA 1b. GKGPPGPPGPRGPC 1c. CHSRHPGDFSC 1d. ASVRMNLGF
Q: A trisaccharide was isolated from a new species of red algae. The sample was hydrolyzed and monosac...
A: Saccharides are the sugar molecule, which forms glycosidic bonds to give disaccharide or or tri or t...
Q: . Potassium: Insulin Overdose, Magnesium: Antacids a. both decreased b. both increased c. firs...
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any sp...
Q: A solution of peptide of unknown sequence was divided into 2 samples. One sample was tre with trypsi...
A: Polypeptides are polymers of amino acids. These are made up of different amino acids.
Q: Under aerobic conditions of high ratios of NADH/NAD+ and ATP/ADP, as pyruvate is utilized for its ca...
A: Glucose is metabolized through the glycolytic pathway to yield energy in the form of ATP and NADH. P...
Q: Myoglobin and hemoglobin differ in...
A: Both hemoglobin and myoglobin contain a prosthetic group that is called heme protein that act as oxy...
Q: 25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. D...
A: A codon is a trinucleotide sequence of nucleic acid that corresponds to a specific amino acid. The g...
Q: The membrane phospholipids phosphatidyl serine and phosphatidyl choline are named based on ...
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
Q: Cells copy DNA to make RNA to make proteins. RNA is the messenger. Why use RNA at all? Why not make ...
A: The process of formation of RNA from DNA is known as transcription. And the process of making protei...
Q: sketch a graph with appropriate axis titles that demonstrate the connections between enzymes and act...
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that ...
Q: How do other biological organisms process sugars? Do they use glycolysis, or if not how do they proc...
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...
Q: You become worried that the flasks would burst open to the build up in gas pressure. What other mole...
A: When glucose is metabolized through glycolysis, there occurs the formation of pyruvate which is conv...
Q: A poultry farmer is curious about the effectiveness of two types of exogenous enzymes, namely papain...
A: Proteolytic enzymes are useful as a supplement to thr diet of ducks and turkeys as well as chickens....
Q: Which of the following molecules is richest in energy when metabolized? O Linolenate, a fatty acid ...
A: Glucose is the primary source of energy for the body. When there is no glucose available, the body d...
Q: DNA repair systems are responsible for maintaining genomic fidelity in normal cells despite the high...
A: Living organisms are constantly exposed to a variety of DNA-damaging substances that can have an imp...
Q: electron transport chain, yet somehow iron is utilized as an electron carrier multiple times. Choose...
A: Electron transport When the electrons pass into the electron transport chain through reoxidation of ...
Q: DNAs are an organism’s blueprint. The code for any trait/character is stored in it. What allows it...
A: The central dogma of molecular biology illustrates the process of the flow of genetic information, f...
Q: a. Provide the a–c cell projection for the space group, b. including a motif Provide all of the gene...
A: In mathematics, physics and chemistry, a space group is the symmetry group of an object in space, us...
Q: Calculate the amount of each solution needed to make 750 mL if a dextrose 25% solution given bony a ...
A: 25 % dextrose solution of 750 ml is to be prepared from dextrose 60% solution and dextrose 5% soluti...
Q: Is this the correct answer of R and T in the blanks or are they switched?
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. These twen...
Q: Which protein is the key to the repeated formation of plaques ?
A: Plaque - Sticky and caused by the gradual buildup of a specific protein fragment.
Q: essential fatty acids
A: Essential fatty acids are essential unsaturated fats that are necessary for human health but our bod...
Q: 1. when ADH level is excessive, the plasma concentration of sodium is __ while water retention is __...
A: ADH: It is a hormone that controls the reabsorption of water molecules in the collecting tubules of ...
Q: What is glycemic index (GI)? Which food in the Philippine market has significant GI and list them wi...
A: GI is also known as Glycemic Index
Q: 1a)What is the purpose of adding 10mM of Tris-HCL (pH 7.5) during the extraction process? Oa....
A: Tris-HCl is an acidic buffer that is commonly used in research labs to resist changes or neutralize ...
Q: Is the following reaction an example of dehydration synthesis and hydrolysis? Explain your answer. C...
A: The given molecule is a disaccharide that is broken down into two molecules of monosaccharides. Mono...
Q: a) What was the full peptide sequence before degradation? b) Paula thought she forgot to treat her p...
A: Edmans degradation is a method of sequencing the amino acids in the peptide. In this first step meth...
Q: Which of the following is the correct glycosidic bond linkage of the disaccharide shown? OH HO но Он...
A: Glycosidic linkage is formed between sugar molecules. The monosaccharide units are joined together t...
Q: CHOH CHOH A CHOH CHOH 1 CH2 CHOH OH CH OH 3 CH.OH он CH CH OH B 2 CH If this were a portion of a pol...
A: A molecule synthesized by living organisms or cells is referred to as a "biomolecule." Carbohydrates...
Q: What is the glycosidic linkage between monosaccharide I and II? α-(1→2) β-(1→2) β-...
A: Glycosidic linkage: Glycosidic bonds formed between monosaccharide units are the basis for the produ...
Q: For the free fatty acid samples, lipase had been added to corn oil and samples taken over time as th...
A: Lipids are organic molecules that are soluble in organic solvents such as ether and chloroform but i...
Q: Which of the following is not true regarding bimolecular reactions? O Kassoc is the inverse of Kdiss...
A: “Question 8 has been answered as requested.” A collision between two reactants initiates the bimolec...
Q: Explain with an example the statement: Enzymes enhance reactions but are not consumed in the reacti...
A: Enzymes enhance reaction rate but are not consumed in the reaction
Q: A corn geneticist wants to obtain a corn plant that hasthe three dominant phenotypes: anthocyanin (A...
A: Cross over: It is important for the normal segregation of chromosomes during meiosis and to produce...
Q: Choose one example of a carbohydrates with a chiral carbon and draw its Fisher's and Haworth's struc...
A: Carbohydrates are classified as monosaccharides, oligosaccharides, and polysaccharides based on the ...
Q: Per NADH consumed by Complex I, indicate the number for each, AS those reducing equivalents flow thr...
A: The electron transport chain is a series of electron carriers through which the electrons are carrie...
Q: Why are buffers important in living systems?
A: Many biochemical processes require the maintenance of pH within a narrow range for proceeding at the...
Q: 2) oxaloacetate (OAA) occurs as an important intermediate in 2 metabolic processes a) indicate these...
A: "Since you have posted multiple questions we will answer the first question for you. If you want the...
Q: . which of the following will cause validation and make sure that the blood pressure will go back to...
A: Answer 3: c . Aldosterone Aldosterone causes an increase in salt and water reabsorption into the bl...
Q: simple explanation about proteins and its important part.
A: Proteins are one of the most important components of body. 4 calories of energy is generated from 1 ...
Q: Which of the following statements best describes the role of the enteric coating on aspirin tablets,...
A: Aspirin, also known as acetylsalicylic acid, is a drug that can be used to relieve pain, minor aches...
Q: BIM-46187 is a protein inhibitor that binds to the a-subunit of the G. protein. It prevents the GDP/...
A: Cell signaling is the conversion of the information in a signal into cellular response. Ligands, rec...
Q: Choose ONE of the bond types listed below which most accurately describes the bonds involved in stab...
A: Proteins are macro-molecules that are made up of amino acids. Amino acids are the basic structural a...
Q: Glucose can be isomerized to fructose to glucose isomerase. The enzyme kinetics of this enzyme was s...
A: From the Given Data, I have plotted the XY plot where, 1/S is on X-axis and 1/V on Y-axis. This is c...
Q: Which test can be used to differentiate maltose and sucrose? Molisch Test Seliwanoff’s T...
A: Molisch Test : Detection of carbohydrates Seliwanoff’s Test : Distinguishes between ketose, aldose ...
Q: what substances interfere with the tests for fructose? for lactose?
A: Seliwanoff's test is the qualitative test for the detection of ketose sugars in a sample. The ketose...
Q: I. Qualitative Analyses of Proteins Complete the table below. Chemical/reagent used (be specific) Fi...
A: Answer of above solution is:
Q: Biology Section 12BC / School Year / We. kl197624 All changes saved 8. In Labrador Retrievers, coat ...
A: The term epistasis refers to a type of gene interaction when one gene masks or modifies the expressi...
Q: Q5) A 3.0-mCi source of 3"P is implanted in a tumor to give it a 24-Gy dose. The half-life of 2p is ...
A: In question 3.0 mCi source of P32 is implanted to give 24-Gy dose of radiation to tumor cellHalf lif...
Q: Kindly answer 16, 17, 18, 19, and 20. Provide the letter of its answer
A: 16.The correct option is (c) Phosphatidylcholine 17. The correct option is (a) Membrane lipids
Q: Which amino acid in globin proteins is responsible for binding oxygen? Question 33 options: Gl...
A: Hemoglobin is the protein which helps in oxygen transport in the body. Hemoglobin is composed of a p...
1. For each of the sequences given below, list what type of secondary structural element, if any is most likely to be formed by that amino acid sequence.
1a. SEGEWQLVLHVWA
1b. GKGPPGPPGPRGPC
1c. CHSRHPGDFSC
1d. ASVRMNLGF
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)Based on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
- 1. A DNA base sequence transcribed into messenger RNA in the following sequence: TTATCTTCGGGAGAGAAAACA. a. If you read from left to right, what amino acids are coded by this sequence? (Note: The initiation sequence is disregarded in this example.) b. If proflavine treatment caused the deletion of the first adenine nucleotide on the left, describe the changes that would occur in the first six amino acids coded by this sequence?Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'give the amino acids specified by the following bacterial mRNA sequences. a. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′ b. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′ c. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′ d. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′
- 1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that produces the amino acid sequence shown above would be characterized as a missense mutation? Select one: O A. CUC UAG GGU GGC GUA OB. CUC UAC GGG GGC GUA OC. CUC UAC GGU GGC GCU O D. CUC UAU GGU GGC GUAWhich of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAAWhich of the following mutations would cause a missense mutation in the sequence shown above? Select one: a. Replacement of second thymine base with cytosine base b. Replacement of second guanine base with thymine base c. Replacement of last adenine base with guanine base d. Replacement of first guanine base with adenine base
- 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…