1. Monoclonal antibodies. Their receipt and use in medical practice.

Q: When an individual is androgynous, they identify with both genders male gender neither gender female…

A: Androgyny• Androgyny is a term derived from the Greek words andras  (meaning man) and gyne (meaning…

Q: Which of the following is wrong for the description of protein synthesis (A) The large ribosomal…

A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…

Q: 9) The the function. and the of amino acids determine the shape of proteins, while the a. property,…

A: Proteins are vast and complex molecules that are required for the normal functioning of living…

Q: 2. Newborn babies used to be put in tanks of pure Oxygen; however, many babies were discovered to…

A: It used to be standard procedure to place newborn infants in tanks of pure oxygen to help their…

Q: Where in messenger RNA does protein synthesis begin and end? Is there an amino acid that stops…

A: Protein synthesis is the biological process by which cells build proteins, which are essential for…

Q: Which of the following relates to polycystic kidney disease? Select one: A. It affects infants and…

A: A hereditary illness known as polycystic kidney disease (PKD) is characterized by the development of…

Q: Three babies were born in a hospital on the same night, and their blood groups were later found to…

A: There are mainly four blood groups, namely A, B, AB and O and this is called ABO type. The test that…

Q: A man comes to the Walk In clinic complaining of a golf-ball sized mass near his left groin. Upon…

A: Bacterial infections can impair multiple organs in the human body and are caused by various types of…

Q: 27. The sympathetic nerves supply: a) The external sphincters of the gastrointestinal & urinary…

A: Nerves are specialized cells in the body that transmit signals between different parts of the body.…

Q: A child with cystic fibrosis can be born to two parents who do not have the disease, but who both…

A: The genetic disorder Cystic Fibrosis (CF) affects the respiratory, digestive, and reproductive…

Q: Main question I need for notes: If evolution is true then why do new species seem to appear out of…

A: The geologically changed remnants of a formerly lived organism and/or its behavior are called…

Q: Diagram a cell and show where proteins, nucleic acids, carbohydrates, and lipids are located.

A: All living organisms are composed of organic compounds known as biomolecules. These biomolecules…

Q: 11. In the leaves of most plants, where can chloroplasts be found? in the upper epidermis and…

A: Chloroplast is an double membrane bound organelle that plays a major role in photosynthesis.…

Q: for normal hemoglobin in blood is represented by curve "D," at a pH concentration of 5mM BPG and 26…

A: The oxygen–hemoglobin dissociation curve is a curve that plots the proportion of hemoglobin bound to…

Q: Describe the epidemiological model for injuries and provide three examples of how energy causes…

A: The epidemiology of injuries is a branch of public health that focuses on the occurrence,…

Q: How can the 4 nucleotides present in DNA code for the 20 different amino acids found in proteins?…

A: Adenine (A), thymine (T), guanine (G), and cytosine (C) are the four nucleotides found in DNA. These…

Q: Question 4 Which of the following information molecules is double-stranded? O deoxyribonucleic acid…

A: Genetic material is the component of a cell that contains the genetic information that can be passed…

Q: Which of the following would likely result in the formation of RNA? Group of answer choices…

A: RNA (ribonucleic acid) is a type of nucleic acid that plays a crucial role in gene expression and…

Q: Which of the following is not a characteristic of the phylum Chordata

A: The phylum Chordata is a group of animals that includes vertebrates (animals with backbones) as well…

Q: Clearly, Marissa-Eve never had any input as to whether her bone marrow should be used to save her…

A: A bone marrow transplant is a treatment that replaces bone marrow which isn't creating adequate…

Q: Female fruit flies from a true-breeding strain with yellow body and cut wings are mated to male…

A: The physical separation between the positions of two genes on a chromosome is referred to as the…

Q: You digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10…

A: ANSWER) The amount of DNA digested can be calculated as follows: Total amount of DNA = volume x…

Q: Search for information on these medium birds: 1. Pigeons B. Then Explain the steps of each of the…

A: Pigeons belong to the class Aves or birds and order Columbiformes. The family of pigeons is…

Q: Coding strand: Template strand: 5' AAGACCTATATAATGACGAACGATATT 3 3 TTCTGGATATATTACTGCTTGCTATAA 5

A: Transcription is the process that synthesis the mRNA transcript from the double-stranded DNA by the…

Q: 1. Describe the general anatomy of the digestive tract by briefly tracing the path taken by a food…

A: The digestive system is an complex framework that involves the coordinated operations of numerous…

Q: 4. Complete the following chart. ✓✓✓✓ Function Composed of Bond Carbohydrates Primary source of…

A: Lipids and proteins and nucleic acids are called biomolecules . They are essential for correct…

Q: Four of the five answers listed below are characteristics of cnidarians. Select the exception.…

A: Cnidarians are a group of invertebrate animals that include jellyfish, sea anemones, corals, and…

Q: The result of completed apoptosis of a cell is apoptotic bodies, which are numerous vesicles of the…

A: Apoptotic bodies are recognized and engulfed by specialized immune cells called phagocytes, which…

Q: Three babies were born in a hospital on the same night, and their blood groups were later found to…

A: A, B, AB, and O are the four primary blood types. The presence or lack of specific antigens on the…

Q: 1.What difficulties does one encounter when trying to differentiate bacteria on the basis of…

A: The catalase test is useful for differentiating staphylococci from streptococci because these two…

Q: THE GENES A, B AND C ARE LINKED ON CHROMOSOME 2 OF S. CEREVISIAE. IN A SERIES OF TWO-POINT MAPPING…

A: In genetics, linkage refers to the tendency of genes on the same chromosome that are adjacent to…

Q: 6) The autoclave desired Temperature to kill bacterial spores must be left for at least ____ in…

A: An autoclave is a device used in laboratory and medical settings to sterilize equipment, materials,…

Q: 1002 offspring. to nisone osld ritiw betulloq zow his srit bos wahans Introductions, Beto Reflect…

A: The majority of peppered moths found in England in the early 1800s were light gray along with black…

Q: Discuss the relationship between oxidation and reduction reactions and enzymes in the various…

A: Metabolic reactions are chemical reactions that occur within living cells, involving the conversion…

Q: 6. You are studying the physiology of hypertension (high blood pressure) using the rat as a model…

A: Hypertension, often known as high blood pressure, is a chronic medical condition that affects…

Q: You just finished plating your electroporatio products on your YPD-Zeocin plate and you think you…

A: Electroporation is a technique used to introduce foreign DNA into cells by applying an electric…

Q: Question 4. RT-PCR differs from PCR because: a. The template used for amplification is RNA b. The…

A: RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) is a modification of the traditional PCR…

Q: Which of the following can cause frequent urination in patients with benign prostatic hyperplasia?…

A: The prostate gland is a gland located in the male reproductive system. It is a small walnut shaped…

Q: In tomatoes, spherical fruit shape is dominant to oblate, and tall is dominant to dwarf. o = oblate,…

A: In tomatoes, spherical fruit shape(O) is dominant to oblate(o), and tall(D) is dominant to dwarf(d).…

Q: 4. Identify two type of endocytosis and explain how they work to transport molecules across the cell…

A: Endocytosis is a cellular process by which cells absorb substances from the external environment by…

Q: 1. Circle the bonds in the drug molecule below that could be hydrolyzed by metabolic enzymes. OCH₂…

A: When an enzyme uses water to break a complex molecule into simpler substances then this process is…

Q: Specific genetic links have been shown for which of the following cancer? I. Cervical cancer II.…

A: Cancer refers to a group of diseases characterized by the abnormal growth and division of cells that…

Q: You have a suspension of fungal cells and have narrowed it down to 2 different types of fungus. You…

A: When a suspension of fungal cells contains two different types of fungus it is often necessary to…

Q: Why does the food industry continue to investigate new methods of food preservation? What is the…

A: Food preservation involves preventing the growth of microorganisms that lead to contamination and…

Q: H. Pylori 1. which one is the most effective treatment and how effective are the other options? 2.…

A: *NOTE: Kindly repost for other questions* Dear Student as per the guidelines we are supposed to…

Q: Question 6. What are the first three amino acids in the protein that is produced from this gene?…

A: Genetic code exists in the form of codons and these codons are the sets of three nucleotides. There…

Q: K-strategists __________. Question 10 options: typically produce larger offspring…

A: In ecology, reproductive strategies relate to the numerous adaptations that organisms adapt to…

Q: Describe the optimal environment, test, drug vaccine and course of action to help treat TB.

A: Tuberculosis, often abbreviated as TB, is a bacterial infection caused by the bacterium…

Q: 20. You are modelling a genetic circuit shown above on Simbiology. What would the Reaction Rate…

A: Simbiology is a software application that is used to model and simulate biological systems,…

Q: Which of the following statements about spermatogenesis is true? Select one: A. The process starts…

A: Spermatogenesis is the process of the development and maturation of sperm cells in the testes of…

Defense Mechanism

Circumstances influence and compel people to behave in a certain way. One such behavior is a defense mechanism. It is employed by people to escape from unpleasant circumstances, thoughts and actions. Defense mechanisms are, thus, psychological strategies that help to avert and avoid unwanted feelings such as guilt or shame and situations such as threat and danger.