Q: Define sustainable development. What is meant by the triple bottom line? Why is it important to purs...
A: Humans have affected nature on a large scale.
Q: 14. How many purines are there in chromosome 14 the human genome (Hsapiens), version hg19? 15. How m...
A: 14. Chromosome 14 spans more than 107 million DNA building blocks or base pairs and it represents ab...
Q: Homeotic gene expression _______. a. occurs via bacterial operons b. maps out the overall body plan ...
A: These are the genes which helps in the development of anatomical structures. Types of Gene Regulatio...
Q: Differentiate an autosome and a sex chromosome.
A: Autosomes are the chromosomes that are involved in determining somatic characteristics of an individ...
Q: What are the basic concepts and precautions to be observed in specimen collection for Microbiologica...
A:
Q: Cleavage Ligand Precursor Receptor Inactive Receptor Active www 99 Cell Membrane 6. The figure above...
A: In case of hydrophilic signalling molecules (ligand), they binds with specific transmembrane recepto...
Q: Are you a hidden heterozygote? A PCR analysis (part2) Agarose gel electrophoresis and interpretation...
A: Agarose gel concentration More the concentration of the agarose gel more smaller will be its pores....
Q: A, B, and C are three different island species and all share a common ancestor. Their ranges are sho...
A: Vicariance approach the geographical separation of a population, generally through a physical barrie...
Q: Illustrate the chromosomes in the salivary gland of Drosophila melanogaster
A: Drosophila melanogaster have polytene chromosome in their salivary gland.
Q: Nucleotides - U - T -Sugar & Phosphate - Anticodon - Codon - Ribose - Transcription - Transl...
A: The central dogma consists of DNA to DNA (Replication) DNA to RNA (Transcription) RNA to proteins (...
Q: Problem 1. A male black (BB) and polled (PP) Angus is crossed with a female black (BB) and horned (p...
A: Problem1 We have, cross between a male black and polled Angus (BBPP) with a female black and horned ...
Q: is an important intracellular event exploited in all of the following pathways: Wnt/?-catenin, Hedge...
A: The all the given pathway are regulated by the phosphorylation as well as by the transcription regul...
Q: What are chromosomes? Give their importance.
A: Introduction: A chromosome has generally 8 parts; Centromere or primary constriction or kinetochore,...
Q: A nucleosome consists of (a) DNA and scaffolding proteins (b) scaffolding proteins and histones (c) ...
A: A nucleosome is defined as a 3D structure composed of approximately two turns of DNA wrapped aroun...
Q: In which of the following plant group the gametophyte is the dominant generation? Group of answer ch...
A: Gametophyte generation is the life cycle of the haploid stage or the stage of the gametes. The sporo...
Q: There are a number of conserved sequences found in an mRNA that dictate where splicing occurs. Where...
A: In molecular biology, After the mRNA gets synthesized from the DNA, the raw mRNA has to be processed...
Q: Which of the following characteristics are present in Vertebrates? Choose all that apply. O triplobl...
A: 1) Triploblastic : Triploblastic animals are those in which the the blastoderm layer divides in thre...
Q: 33. Band 3 protein exists as a 95-kDa multipass membrane protein that functions as the primary anion...
A: E is the correct answer. Band 3 protein functions as an anion exchanger, exchanging bicarbonate ion ...
Q: 4.) During DNA replication, the two strands of DNA are pried apart and then serve as templates for s...
A: According to our guideline we can answer only the first question. The second question is completely ...
Q: I. A 29-year-old woman (gravida 3, para 2) gave birth to a healthy baby after 38 weeks of gestation ...
A: The correct answer is d. The chorionic villi, or foetal tissues, illustrated in the photomicrograph ...
Q: Propose an explanation for bacteria, chloroplasts, and mitochondria all having ATP synthase complexe...
A: Mitochondria breaking down fuel molecules and capturing energy through cellular respiration Chlo...
Q: List the main events that occur during each stage of mitosis.
A: Introduction: The process of cell division that results in the formation of two new daughter cells i...
Q: Match the rodent ovulatory cycle phase with the correct hormone combination Proestrus x Peak Progest...
A: The term menstrual cycle is associated with the occurrence of cyclic ovarian activities in mammals. ...
Q: While there are many criteria to describe the difference between two species, the biological definit...
A: There are many criteria to describe the difference between two species.
Q: Provide eight morphological endemic species from the Philippines.
A: *Endemic Species means the species of plants or animals which are found in a particular region or ...
Q: 7. In pea plants, inflated pod is governed by a completely dominant gene and a constricted pod by a ...
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous c...
Q: This type of passive transport : •does not require ATP •uses transport proteins to increase the rate...
A: Passive transport Substances are allowed to cross the cell membrane without any input of energy. typ...
Q: researchers identified the important role of GNAQ in both development and cancer
A: GNAQ is G Protein subunit Alpha Q.It is a protein coded gene present on chromosome 9.It is a guanine...
Q: How to persuade a faith healer about the advantages and benefits of the Scientific and Bio-medical P...
A: Faith healing has defined the process of healing a person with disease or disability by religious be...
Q: What is the importance of Bracing the core through 90-90 Hip Lift with Left Pelvic, Right Arm Reach ...
A: The importance of Bracing the core through 90-90 Hip Lift with Left Pelvic, Right Arm Reach and Bal...
Q: Two loci exhibit 5% recombination between them. How many map units apart are they?
A: Genetics is a branch of science concerned with the study of genes, genetic variation, and heredity i...
Q: The Arctic is an example of a harsh environment. Plants living in the Arctic are faced with many cha...
A: The Arctic is located at the northernmost part of Earth. Temperatures of this region in winter can d...
Q: hat are the differences of hibiscus from other kingdom?
A: Hibiscus belongs to Kingdom Plantae. Differences of Kingdom plantae from other kingdoms are mentione...
Q: True or False: if an organism is multicellular, you can be certain that it is not a bacterium.
A: Multicellular: These are the organisms which consists of more than one cell Examples include human ...
Q: This molecule: •contains potential energy •is used to convert CO2 into glucose •has an unstable trip...
A: The molecule is ATP and it has unstable triphosphate tail , the main energy sources comes from hydro...
Q: H2N 1.) Look carefully at this nucleotide: N- || НО-Р-О- N. OH a.) Number the carbons in the sugar g...
A: DNA is a long, double-stranded, helical molecule composed of building blocks called deoxyribonucleot...
Q: The greatest trophic diversity is found in which group of organisms?
A: Trophic means the hierarchical strata of a food web or nutrition. Trophic diversity means nutritiona...
Q: What would have happened if the darwinian revolution did not unfold?
A: Darwin revolution is revolution after his book origin of species.
Q: 17. A culture of Spirogyra (an autotrophic alga) is maintained in a water solution containing dissol...
A: Lifeforms are composed of 4 biomacromolecules. They are carbohydrates, proteins, lipids and nucleic ...
Q: What are the differences between hnRNAs, snRNAs, miRNAs, siRNAs, and snoRNAs?
A: hnRNAs, snRNAs, miRNAs, siRNAs, and snoRNAs are the different classes of small RNAs involved in diff...
Q: What are the current trends and innovations in International Blood Bank Laboratories?
A: Recent innovations in the field of Blood Bank Laboratories are:- Blood Bank Information System: - C...
Q: elping tags: Biology, development, developmental biology, plants, cell elongation How is it that th...
A: Plant cell wall is dead for the fact that it is not composed of any living cell. This raised a quest...
Q: A Staphylococcus aureus undergoes a lac operon mutation that prevents repression of structural genes...
A: Lac operon - Lac operon or lactose operon is the DNA segment that controls the metabolism of lactose...
Q: Which pioneers of microbiology had the biggest impact on surgical patient care?
A: Introduction:- Microbiology always helps us to create numerous medical advancements in terms of unde...
Q: How many different types of alterations in chromosomal numbers are there? -How can I use the F plas...
A: Uracil is a compound present in RNA base, it is replaced by thymine in DNA.
Q: Explain the significance of mitosis and describe the process.
A: Mitosis is a type of cell division in which the number of chromosomes is preserved( i.e. remains sam...
Q: Phases of meiosis Prophase I a) DNA coils tightly to form visible chromosomes which appear rod-sha...
A: Meiosis is a process where a single cell divides twice to produce four cells containing half the ori...
Q: Describe three types of post-transcriptional regulation of protein coding genes.
A: Introduction Genome is referred to the total amount of DNA a single haploid cell contains. Genome i...
Q: O Al membrane-bound organelles of the endomembrane system. O The Golgi Apparatus O Peroxisomes and t...
A: Answer-24- chloroplast and mitochondria Chloroplasts and mitochondria are energy-converting organell...
Q: An organism characterized as a photoautotroph obtains energy from _______________ and carbon from __...
A: Photoautotrophs are green plants that transform carbon dioxide into carbohydrates in the presence of...
Genetic Variation
Genetic variation refers to the variation in the genome sequences between individual organisms of a species. Individual differences or population differences can both be referred to as genetic variations. It is primarily caused by mutation, but other factors such as genetic drift and sexual reproduction also play a major role.
Quantitative Genetics
Quantitative genetics is the part of genetics that deals with the continuous trait, where the expression of various genes influences the phenotypes. Thus genes are expressed together to produce a trait with continuous variability. This is unlike the classical traits or qualitative traits, where each trait is controlled by the expression of a single or very few genes to produce a discontinuous variation.
Step by step
Solved in 2 steps
- U JUmething new. umpulate genes focusing on the physical traits among Ang can be used value or can tileate NDII. TIS helude selective breeding, hybridization and inbreeding. 3. Genetic engineering is referred to various techniques used for the modification or manipulation of organisms through the processes of heredity and reproduction. 4. This includes cloning, gene splicing, gel electrophoresis and DNA recombinant technology. 5. Recombinant DNA technology use to remove and insert genetic sequences from and into other sequences of other organism. 6. The tools used in Recombinant DNA technology are restriction enzymes, vectors and host organisms. A sot Tist in which pnces the Ond bislistice. In ex ternal DANA into + trans yertion To Hed int GE Activity 3 org SOR Directions. Distinguish the techniques in genetic engineering as based on the situation and examples given. Write the letter of the choices. A. Artificial selection B. Selective breeding C. Hybridization D. Inbreeding E. Cloning…Part 2. PCR 1) In one color, write out the forward primer (5’ GATAC 3’) in the correct position relative to the given template DNA sequence. In a second color, act as the polymerase and fill in the rest of the new strand of DNA Primer/New Strand Template DNA: 3’ TAGCTATGCGGACCTCATGCATTAGAGTAG 5’ Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and…1a-Consider a situation where the primer sequences used in a PCR reaction are synthesized to be complementary to a mutation in the human genome that leads to a genetic disorder. Which of the following statements is true? a- The PCR reaction will work if you use template DNA from someone who has the disorder. b- The PCR reaction will work if you use template DNA from someone who does not have the disorder. 1b- In the diagram attached, can the jellyfish DNA be directly treated with DNA ligase so that its genome is reassembled and lacks the GFP gene? a- No b- Yes
- OO HUAWEI Nova 2 Plus DUAL CAMERA tem (Academic) c. Heat shock. d. Floral dip. O e. Electrophoresis. The hybridization between DNA during the library screening process take place between probs and CDNA of the organism when: Select one: O a. Van der Waals forces. O b. Hydrogen bonds form between the complementary DNA sequences. O c. Covalent bond form between the complementary the DNA sequences. O d. Glycosidic bonds. e. Phosphodiester bond and cause ligation the DNA sequences. NextMICROBIOLOGY How can homologous recombination affect genome evolution in bacteria? Describe at least TWO mechanisms.5. Watch the video: https://www.youtube.com/watch?v=ml0Fo9kaWqo&t=38s. Based on the information in this video and material covered in class answer the following questions: A. In a Sanger sequencing-based PCR reaction, how many primers are added? B. In a Sanger sequencing-based PCR reaction, which molecules are more common: DNTPS or fluorescent terminators? C. What is a typical length of sequence that can be acquired using traditional (Sanger) sequencing? D. The results from sequencing one stretch of DNA is called a "read". How many reads can be obtained from a run on a 384-well plate Sanger sequencing instrument vs. a NovaSeg instrument? E. How many gjgabases of sequences can be obtained on the Sanger vs. NovaSea instruments? Regarding F. and G., the adaptor sequences have two parts: primer binding sites and capture sequences. F. Once the (denatured) DNA has been loaded into the flow cell, which adaptor sequence part is hybridized to other single-stranded DNA first? G. How many copies…
- 6. Explain why a positive test for COVID19 would appear sooner than a negative result when using real- time PCR to test if someone is infected. 7. Explain why the same primers (GMM) could detect several types of genetic modifications to common crop plants, rather than one specific gene or genetic modification. 8. Explain the general procedure for using the NanoDrop machine in analyzing DNA samples. Be sure to explain the purposes of the blanks (pure water), and of the importance of the 260/280 ratio. Identify an ideal 260/280 ratio of purified DNA.7. How could genetic engineering be of use to humans? Describe at least 2 different uses.8. What was the genetic marker used in this experiment? Be specific.9. What enzyme helps to “glue” the donor DNA and plasmid together to form recombinant DNA?Part 3. Compare the Specificity of DNA-Cutting Tools The flexibility and specificity of CRISPR-Cas9 technology offer a large step forward for gene editing. The first DNA "scissors" were restriction enzymes, which cut DNA at predefined sequences, typically 4-8 base pairs long. For example, EcoRI, a restriction enzyme found in E. coli, will cut double- stranded DNA at every GAATTC sequence. If EcoRI were added to a sample that contained the entire human genome, it could cut at every GAATTC sequence. We can calculate the probability that a particular nucleotide sequence, such as GAATTC, will occur within a larger sequence. Table 1 below shows the calculated probabilities of finding sequences of particular lengths. These calculations are based on the assumption that DNA sequences are entirely random and that every nucleotide position has an equal probability of being A, T, C, or G. Use the table to answer the following questions. Table 1. Calculated probabilities of finding a specific…
- 18. CRISPR can change DNA in animals. What did scientists look at in the nature to help them create CRISPR? Question 18 options: Bacteria fighting off viruses Sheep cloning antibiotic resistance cell survival 19. Identify the disease: •It affects mainly males. •Affected males are usually born to unaffected parents; the mother is normally an asymptomatic carrier but may have affected male relatives. •Females may be affected if the father is affected and the mother is a carrier. Question 19 options: X-linked recessive X-linked dominant Y-linked Autosomal recessive1. What is DNA cloning of animals and plants? 2. What is the importance of DNA cloning? 3. Give example or scenario that involves DNA clining (could be taken on the internet). please answer 1,2,3. thank youGenetically Modified Foods The creation of transgenic crop plants using recombinant DNA methods involves the transfer of just one gene or a small number of genes to the plants, in contrast to classical breeding methods in which hundreds or even thousands of genes are transferred at once. Explain why this is true. If fewer genes are transferred during the creation of transgenic crops, why are some people afraid that they are dangerous?