3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T ACGCGTATACCGACATTC MRNA: Codon: Anitcodon: Amino Acids: A8m Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: CGAT ACAATGGACCCGGTATGCGATATCC DATAA
Q: 9 The table opposite shows the standard riplet codes for the 20 amino acids involved in protein…
A: Transcription is the process in which the DNA strand which codes for a protein and e converted to…
Q: it mRNA will be formed from the template strand of DNA? AUGGUGCA at amino acids will this mRNA code…
A: The process by which DNA template synthesizes messenger RNA is called transcription. The other…
Q: 5)Which type of nucleic acid would have the sequence "ACCGAUUG"? a)DNA b)mRNA c)Another type of…
A: Carbohydrates, amino acids, fats, and nucleic acids are the most important biomolecules found in…
Q: 1.) A portion of a strand of a much longer molecule has a nucleotide sequence AGC – AGG – CAG - ATC,…
A: Deoxyribonucleic acid (DNA) is the genetic material of living organisms. DNA provides the…
Q: GS 42 CI G4 AUG AUG CUC CUC ACG GAC Uuc UAC CGG R (the strand Y CUC GAG AAG The circled structure…
A: The process shown in the image is Translation where with the help of ribosome and tRNA from the mRNA…
Q: 5. A DNA sequence of "ACG" will code for the amino acid - (LS1- 1) * Second mRNA base C. UUU Phe UUC…
A: Gene expression refers to the complex, highly-regulated biological process, which involves the…
Q: DNA TAC GAC CAA TCG GAT TAC CCC GAA TGT MRNA Amino Acid DNA TAC CGC GGG ACC TAT CGT CGA GCG ATG MRNA…
A: the DNA contains several bases that help to produce amino acids. every codon is responsible for…
Q: 3)What would be the third amino acid produced by the DNA strand: T A C C G A G T C A C G (Hint: use…
A: In translation, the newly formed mRNA is decoded in a ribosome. The ribosomes facilitate decoding by…
Q: 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the mRNA…
A: The coding strand of DNA is the one that contains the instructions for the gene in concern. The…
Q: The strand of DNA contains the sequence of bases: CGA CCG TAC. What is the sequence of the…
A:
Q: Considering each nucleotide sequence in an mRNA molecule: [1] write the sequence of the DNA template…
A: Gene expression is the process by which the instruction in the DNA is converted to products through…
Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…
A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…
Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…
A: A codon is a group of three nucleotides in an mRNA grouped to code for a particular amino acid. The…
Q: 7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide…
A: DNA to mRNA is transcription and mRNA to protein is translation.
Q: 5. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…
A: point mutation - change in single nucleotide sequence which alter the amino acid .
Q: I have a question I'm not sure about here it is...... If a short sequence of DNA is…
A: The Correct option is 2.DNA (deoxyribonucleic acid) is a double stranded molecule in which the two…
Q: 3. Using your Genetic Code, translate and group the following MRNA bases. Example: UAC CAG UGG UUU…
A: a. 5 'CUC GGU ACG UAA UAG AUC UAU CAU CCG AGA CUC UUA AAU 3' ANSWER: 5' Leu Gly Thr Stop Stop Ile…
Q: 2: Translation Translation MRNA Codon Amino Acid GAA Glu ACG GAU UAC CAG CCC AUG GGC
A: Translation includes the decoding of the information in the mRNA (messenger RNA) into the functional…
Q: 1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ mRNA: polypeptide chain:
A: (According to our regulations, we are required to answer only the first question in case of multiple…
Q: The following is a strand of DNA. Please write out the correct mRNA that ll DNA strand and make sure…
A: Messenger RNA is a single-stranded RNA molecule that is complementary to one of the DNA strands of a…
Q: 3. What mutation(s) would change the original peptide to Met lle Arg? codon 2 4. What mutation(s)…
A: DNA Sequence - TAC ATG GAC AAT GAT TAG GGG RNA Sequence - UAC AUG GAC AAU UAG GGG Codon - 1 - 2 - 3…
Q: 63 62 GI G5 G4 GGU AUG GCC AUG CUC TT T GAG CGG ACC CUC UUC UAC R (the strand) GAG AAG The circled…
A: Gene expression refers to producing protein from the template strand of DNA via mRNA as an…
Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…
A: DNA acts as genetic material in most organisms. DNA gets transcribed into mRNA by an RNA polymerase…
Q: DNA 11. A A 12. UC G MRNA 13. U G G tRNA Amino Asparagine Acids 14. 15. ler 3 codons equal one…
A: Messenger RNA (mRNA) is a large family of RNA molecules, which transfer the genetic information…
Q: 1. What is the sequence of the peptide that would result following translation with a ribosome?…
A: A codon is a three-nucleotide (tri-nucleotide) sequence of DNA or RNA that corresponds to a specific…
Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…
A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…
Q: Which of the following statements about mRNA is correct? a. Eukaryotic mRNA is generally…
A: Introduction:- Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…
Q: 7. Look at 6a and 6b. Compare the RNA sequences and the polypeptide sequences they code for. What…
A: A base pair is two nucleotides that together constitute a DNA ladder." A DNA nucleotide is composed…
Q: 11. Now imagine that a mutation occurred in the second T of the codon below and the T became a G.…
A: Introduction: The genetic macromolecule referred to as DNA is highly stable with regards to its base…
Q: 2. An mRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Introduction DNA is the hereditary material in humans and almost all other organisms. RNA is used to…
Q: How many nucleotides are in 13 MRNA codons? Lütfen birini seçin: O a. 13 O b. 26 O c. 39 O d. 78
A:
Q: 1. Below is a sequence of DNA bases. =T ACTTCACG AGTGAGACT a) Transcribe to MRNA: AUGAAGUGCUCACUCUGA…
A: Transcription is a process in which the DNA sequence is converted to mRNA. In mRMA there is Uracil…
Q: Bēlöw is thế TEMPLATE strand of DNA for a particular gene. Template strand: 5' AATCАTAAСТСАТTG 3' A.…
A: The two types of strands in DNA are coding (non-template) and template (non-coding). Both strands…
Q: is a single stranded RNA molecule held together by hydrog bonds. Answer: MRNA Which of these DNA…
A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…
Q: 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA.…
A: The double-helical structure of DNA was transcribed into mRNA molecules and these mRNA molecules are…
Q: 11. Transcription is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…
A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…
Q: What amino acids are specified by the following base triads on DNA? a. TCA b. CCt c. GGC d. GAT e.…
A: A genetic codon is a triplet nucleotide sequence of RNA molecules that were formed from the…
Q: 2a. The DNA is mutated on the 4th base pair to the following: DNA:3'TAC GAT GAG GTC TGA ACT 5' 5 ATG…
A: Mutations are changes in the base pair that can effect the way proteins and mRNA is formed it can…
Q: DNA: GTACGCGTAT ACCGACATIC 4. MRNA: Codon: Anitcodon: A ANO Amino Acids:
A: The sequence of mRNA (messenger ribonucleic acid) is complementary to DNA (deoxyribonucleic acid).…
Q: 5. A DNA sequence of "ACG" will code for the amino acid (LS1- 1) * Second mRNA base U UUU Phe UCU…
A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…
Q: The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA…
A: Hello, thank you for your question. The second part of the question seems to be incomplete,…
Q: 1. A DNA fragment was sequenced; however, the scatter-brained professor lost track of the direction…
A: In a transcription unit; the there are 2 DNA strands. The strand with polarity 3' to 5' is the…
Q: 1. Using the DNA provided transcribe DNA into mRNA. 2. Use the mRNA strand you created and break it…
A: DNA is the main genetic material present in most organisms and stores all the genetic information of…
Q: 6. If the first G changes to A what kind of mutation will happen? Show the change in amino acid…
A: Introduction :- A mutation occurs when the sequence of DNA changes. Mutations can occur as a result…
Q: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA…
A: The central dogma of life involves three processes. They are: Replication: In this process, copies…
Q: 6. The normal sequence a DNA and the MRNA transcribed from it are shown below. DNA-…
A: For the expression of a gene, the nucleotide sequences present in the template strand of DNA are…
Q: A UGUUUU ACCCUA A GUAA GGUAA UAGGUA ACA 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23…
A: Each gene contains information that can be coded for expression. Firstly, one of the two strands of…
Q: 8. DNA → TAC AGA CGG CAA CTC TGG GTG CTT TGT TCT CTT CTC AGT ATC MRNA → protein >
A: The Central Dogma in molecular biology is one of the most important concepts which throws light on…
Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical…
A: Codons are made of three nucleotides of DNA or RNA. Each codon codes for an amino acid. The amino…
Q: Transcribe the corresponding mRNA strand from the given DNA strand: DNA: TAC GCA…
A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid. It is the genetic material of all…
Trending now
This is a popular solution!
Step by step
Solved in 5 steps with 2 images
- A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycineGiven the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?2. Given a DNA template molecule of 5' - ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence and then the polypeptide sequence, starting at the first start codon. mRNA: 5'- CCAU AUG UUA ACU AGU AGG UAG GAG CCA U - 3' Polypeptide: (N) Met-Leu - Thr - Ser - Arg (C)
- 26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C- A- A- G- T- A- C- T- T- G- T- T- T- C- T- T- A- A- A 5' A LIGUULAUGAOLAAAGAAUUL Phe- MRNA: Amino Acids: met Phe- met Asme -LyS- G la- 27. Suppose the two guanosine (G) nucleotides in3 above were changed to two cytosine (C) nucleotides. What is the new amino acid chain? 28. Suppose the two guanosine (G) nucleotides in #3 were removed from the DNA strand. How would this mutation affect the amino acid chain? Write out the new amino acid chain.3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT CCA CAG ACA * AGU AAA GGU GUc UGU 3. Translate the mRNA codons (i.e. your answer to question 2) into the appropriate amino acids using the following Universal Genetic Code Chart. * Universal Genetic Code Chart Messenger RNA Codons and the Amino Acids for Which They Code SECOND BASE A UCU UAU UGU UUU UUC UUA PHE TYR CYS UCC UCA UAC UGC SER UAA UGA STOP LEU STOP UUG UGG} TRP UCG UAG CUU CCU CAU CGU HIS CUC CCC CAC CGC LEU PRO ARG CCA CCG CUA CAA CGA GLN CUG CAG CG AUU AUC ACU AAU AGU AGC AGA ASN SER ILE ACC AAC THR AAA AAGS ACA AUA AUG MET or START LYS ARG ACG AGG S GCU GCC GUU GAU GGU ASP GUC GAC GGC VAL ALA GLY GUA GCA GCG GAA GGA GGG GLU GUG GAG トエーCロ ASE A, L-RST BASE
- w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdfAAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons b. tRAN anticodons c. amino acids5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
- 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding MRNA 5' 1 3' and translate this mRNA into protein. DNA 3' CGTGAATACGCTACGGAACTCACTGGTA 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein UCAGUCAG UCPG Alanine GU U/c GU A Tyrosine C Stop A G Cysteine Valine G A Stop G Tryptophan Arginine A G AC A C UG ACUGACU C Leucine Serine G C A Lysine Proline Asparagine Glycine alanine Leucine Phenyl- Serine Glutamic acid Aspartic acid Histidine Glutamine Threonine1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'15. The following is a list of some mRNA codons representing various amino acids. Met-AUG, Pro - CCC, Phe-UUU, Gly - GGC, GGU Leu - CUA, Arg - CGA, CGG Ser - UCU, Asp - AAU Thr-ACC, Val - GUA His - CAC A portion of a strand of DNA contains the following nucleotide sequence: 5'... AAA GAT TAC CAT GGG CCG GCT...3' (a) What is the mRNA sequence transcribed from it? (b) What is the amino acid sequence of this partially-synthesized protein? Cur or (c) What is the amino acid sequence if, during transcription, the third G on the left in the DNA is read as T? beri (d) What is the amino acid sequence if, during translation, the first two Us of the mRNA are not read and the fourth C from the left in the mRNA is not read or is deleted?