4. What does the amino acid chain form?Codon chart: We interpret MRNA 3 base pairs at a time. This is known as a codon. A codon tablecan be used to translate a genetic code into an amino acid sequence. The full set of relationshipsbetween codons and amino acids (or stop signals) is called the genetic code. The genetic code isoften summarized in a table like the one below.Second letterCGUAU)TUGU)

amino acids are biomolecules which have an alpha carbon on which an amino group and an acid group is…

Answered: 4. What does the amino acid chain form?

Science

Biology

4. What does the amino acid chain form?

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Related questions

Q: 3. How do each pair of the following molecules resemble/differ from each other. (a) glycogen and…

A: Monomers combine to form polymers. These all are carbohydrates. Carbohydrates are called so because…

Q: What determines the shape of our proteins? * O The order of nucleic acids The order of amino acids O…

A: Proteins are the product of translation process coded by the genetic codons in any particular…

Q: 3. What bonds are present in the formation of nucleotide and the binding of a nucleotide to another…

A: Nucleotides are the phosphoric acid esters of nucleosides. It occurs either as free form or as…

Q: Whats the Difference between Amino acids and imino acids?

A: Amino acid and imino acid are the compound of C, H, O and N mainly.

Q: 1. If the second amino would the protein sti

A: Answer. Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. They serve as…

Q: 1. What makes monosaccharides and disaccharides completely soluble in water? Why are polysaccharides…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 4. Which among the given peptides will form hydrogen bond with another similar peptide chain? i.…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: What is the structural difference between ribose and deoxyribose

A: Monosaccharides, or simple sugars, are ribose and deoxyribose. They are aldopentoses that are…

Q: 1. What do the top/bottom of this diagram refer to? It refers to 2. What are the two major groups of…

A: Since there are multiple questions in this particular question I will answer the first one for you.…

Q: 1. Classify the 20 common amino acids A. According to type of side chain, R group a. Neutral amino…

A: Each amino acid has a N-terminal (-NH2 group), a C-terminal (-COOH group) & a R-group or the…

Q: 5. What are the most important organic molecules for living beings?

A: Most of the organic molecules are building blocks of macromolecules. These organic molecules can…

Q: 7. What type of bond is formed between the hydroxyl group of one nucleotide and the phosphate group…

A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…

Q: 7. If a macromolecule such as maltose is separated into glucose and glucose monomers, molecule(s)…

A: Macromolecules such as carbohydrates, proteins, lipid and nucleic acid are important for functioning…

Q: 9. The function of a protein is determined primarily by: 1. Its molecular weight 2. The number of…

A: Proteins are polymers formed by the joining of multiple amino acids. It is the most abundant…

Q: 1. What type of reaction occurs to form sucrose? What is the waste product?

A: Carbohydrates, lipids, protein, nucleic acids are the four classes of macromolecules. Each class of…

Q: 2. How much ATP (energy) is produced from a protein that has 500 amino acids?

A: ATP are energy currency of the cell. They are produced in the mitochondria.

Q: 1. What do you think creates the unique shape of an enzyme?

A: Enzymes are the biocatalyst that increases the rate of a reaction. These enzymes are specific for…

Q: Create a flowchart of Amino Acids and classify them depending on the polarity of its R group.

A: Proteins are known to play an important role in the growth and development of the body and are…

Q: 2. How can a diet that is 90% carbohydrates support the same amount of protein in the human body as…

A: metabolism of carbohydrates

Q: 1. What are the different classes of lipids? State their function and identify their chemical…

A: A group of organic compounds includes lipids that are insoluble or poorly soluble in…

Q: 1. What is the physiological significance of branching in polysaccharides?

A: "Since you have posted multiple questions, we will solve the first question for you. If you want the…

Q: 7. The cis-double bonds in unsaturated fatty acids put an inflexible "kink" in the carbon chain,…

Q: Which statement BEST describes amino acids? Amino acids have an alpha carbon, amine group, fatty…

A: Amino acids are the building block of proteins. Different amino acids joined by peptide bonds and…

Q: 2. How are the complex sugar molecules broken apart? 3. What substance are commonly called lipids?

A: When two monosaccharides are connected by glycosidic linkage, a disaccharide (also known as a double…

Q: 4. A particular amino acld inside or the outside of the folded protein? Briefly explain. on the

A: Amino acid in nature has the same fundamental structure. It consists of a carbon atom, the alpha (α)…

Q: 2. Summarize the major amino acids and their characteristics. 3. Give the characteristic features of…

A: Introduction: Amino acids are molecules that contain an amino group, a carboxylic acid…

Q: 4. What are coenzymes?

A: Introduction :- Small compounds called coenzymes cannot catalyse reactions on their own, but they…

Q: 1. Which one of the following statements concerning the peptide shown below is correct?…

Q: 3. What type of chemical bond maintains the carbon tail of lipids together?

A: The chemical compounds like proteins, carbohydrates, lipids, and nucleic acids are a mandatory…

Q: 2 What Role Does the Amino Acid Sequence Play in ProteinStructure?

A: Proteins are the building blocks of the body. It plays an essential role in the body. Many enzymes…

Q: 4 Distinguish between ionic and covalent bonding.

A: form We have to differentiate between ionic and covalent bond

Q: 1. What makes monosaccharides and disaccharides completely soluble in water? Why are polysaccharides…

A: Biomolecules are organic compounds present in living organisms. Different biomolecules in organisms…

Q: What are the main types of molecules classified as lipids?

A: A lipid is a material that is insoluble in water but soluble in alcohol, ether, and chloroform in…

Q: What lipid types are the components of biological membranes or cellular membranes?

A: Lipids: Lipids are a heterogeneous class of naturally occurring organic compounds that are…

Q: 1. Which of the following molecule can act as molecular chaperons for assisting the folding of…

A: A broad set of unrelated protein families whose function is to stabilize unfolded proteins, unfold…

Q: 6. How are amino acids linked together in a protein molecule? Write the general structure of the…

A: Amino acids are the molecules that join to form a protein structure. The bond formed between two…

Q: 1. When will a protein have the lowest solubility?

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…

Q: Nucleic acids, proteins, and polysaccharides all share a similar structure. How is the structure of…

A: Biological macromolecule are the molecules that synthesize numerous elements of the cell , thus also…

Q: 1. How does a protein carry out its main functionality?

A: Proteins are one of the most abundant molecules that makes up the human body. It is composed of…

Q: 1. What kind of bonds form between nucleotides when they are linked to form nucleic acids?

A: A DNA molecule is a double-stranded helix which is consists of a monomer known as nucleotides. These…

Q: 5. How would the following fatty acid be characterized? A. short chain, saturated B. medium chain,…

A: Fatty acids are the long-chain lipid carboxylic acids found in the body. these are two types based…

Q: 7. What are some examples of the structural function of organic molecules?

A: A complex molecule comprised mostly of carbon atoms bonded to other elements and/or other carbon…

Q: 1. What is monosaccharide , and how can two monosaccharides combine to form a larger molecules?

A: Carbohydrates, lipids and proteins play major role in the cellular structure as well as the…

Q: 7. Give the 2 examples of each of the followings:- (a) hydrophilic amino acid, (b) Charged AA, and…

A: Amino acids can be classified depending on the side chain/group it possess. hydrophilic/polar amino…

Q: 9. Identify the N-terminal and C-terminal amino acid in each peptide. H,N-CH-Ö-Ņ-CH–Ö-o CH2 H CH3…

A: Amino acids are the organic molecule which are linked to form a protein. Each amino acid comprise of…

Q: 6. What are the main functions of the organic molecules for living beings?

A: There are many types of organic molecules important for human beings. Most important ones are amino…

Q: How does a protein carry out its main functionality

A: Protein is a macronutrient that is essential to building muscle mass. It is commonly found in animal…

Q: 1. Why is oil liquid at room temperature, while butter is solid? 2. What are trans-fatty acids? In…

Q: What is an amino acid that has aromatic heterocyclic side chain?

A: Amino acids are monomers of protein they are linked with each other by forming peptide…

Concept explainers

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.

Question

100%

4. What does the amino acid chain form?
Codon chart: We interpret MRNA 3 base pairs at a time. This is known as a codon. A codon table
can be used to translate a genetic code into an amino acid sequence. The full set of relationships
between codons and amino acids (or stop signals) is called the genetic code. The genetic code is
often summarized in a table like the one below.
Second letter
C
G
UAU)
TUGU)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
Most codons specify an _________ . a. protein c. amino acid b. polypeptide d. mRNA
Codon chart: We interpret mRNA 3 base pairs at a time. This is known as a codon. A codon table can be used to translate a genetic code into an amino acid sequence. The full set of relationships between codons and amino acids (or stop signals) is called the genetic code. The genetic code is often summarized in a table like the one below. Second letter A G UUU UUC J UGU Cys UCU) UCC UCA UCGJ UAU U Phe Tyr UACS UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UUG FLeu G CUU ) CỤC CUA CUG CCU ) ССС ССА CCG CGU CGC Arg CAU) CÁC His САА Leu Pro CGA Gin CAG CGG AUU AAU ACU АСC ACA Asn AGU Ser AAC JAsh AGC. AUC le A AUA AGA Arg Thr AAA AAG. }Lys A AUG Met ACG AGG J G GUU GUC G Val GUA GUG GCU) GCC GCA GCG GAU1 GACS GAA) GAG Glu GGU GGC Gly U C A Ala GGA GGG] G First letter UUAG Third letter
A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.
Table 1. The Genetic Code: Codons and Their Amino Acids First Two Nucleotides of Codons Last Nucleotide of Codons The Amino Acids A UU phe phe leu leu Abbreviations Names UC gly glycine ser ser ser ser UA tyr tyr term ala alanine term val valine UG cys cys term trp ile isoleucine leu leucine CU leu leu leu leu ser serine CC pro pro pro pro threonine proline aspartate glutamate lysine arginine thr CA his his gin gin pro asp glu lys CG arg arg arg arg AU le ile ile met AC thr thr thr thr arg asparagine glutamine cysteine methlonine asn AA lys lys asn asn gin AG ser ser arg arg cys met GU val val val val trp phe tryptophan phenylalanine tyrosine histidine GC ala ala ala ala tyr his GA asp asp glu glu GG gly gly gly gly term termination 3. Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space provided. If the letters code for more than one amino acid, separate the names by dashes. b. UUA: c. GAG: d. UAUCUA: e. AUCUUG: f. AAGAGUUCG: g. AAAUUUGGG: h.…
2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT CCA CAG ACA * AGU AAA GGU GUc UGU 3. Translate the mRNA codons (i.e. your answer to question 2) into the appropriate amino acids using the following Universal Genetic Code Chart. * Universal Genetic Code Chart Messenger RNA Codons and the Amino Acids for Which They Code SECOND BASE A UCU UAU UGU UUU UUC UUA PHE TYR CYS UCC UCA UAC UGC SER UAA UGA STOP LEU STOP UUG UGG} TRP UCG UAG CUU CCU CAU CGU HIS CUC CCC CAC CGC LEU PRO ARG CCA CCG CUA CAA CGA GLN CUG CAG CG AUU AUC ACU AAU AGU AGC AGA ASN SER ILE ACC AAC THR AAA AAGS ACA AUA AUG MET or START LYS ARG ACG AGG S GCU GCC GUU GAU GGU ASP GUC GAC GGC VAL ALA GLY GUA GCA GCG GAA GGA GGG GLU GUG GAG トエーCロ ASE A, L-RST BASE
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain:b. the leftDNA:mRNA:polypeptide chain:
A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below. DNA DNA ATG CCT TGT GẠC ATG CCT TGA GẠC transcription transcription MRNA MRNA AUG CCU UGU GAC AUG CCU UGA GAC original sequence mutated sequence What kind of mutation will result from the mistake made during DNA replication in the nucleotide sequence above? O A. Silent Mutation B. Chromo C. Nonsense Mutation D. Frameshift Mutation
A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following: mRNA codons tRNA anticodons amino acids
Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter
Which of the lettered arrows in the diagram of translation indicates an amino acid? A/G|G A AUGGG A C
1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out) 2. Figure out the tRNA triplet (codons) that would fit the mRNA triplets. (letter by letter) 3. Look up for each tRNA codon and find the corresponding symbol and amino acid abbreviations. The symbols should spell out a meaningful English message.