6.c. Mutated DNA Template Strand #3: 3'-TACTGAC TGACTATC-5' Complementary DNA sequence: mRNA sequence transcribed from template: Amino acid sequence of peptide: Type of mutation: 6.d. Mutated DNA Template Strand #4: 3'-TAC GAC TGACTATC-5' Complementary DNA sequence: mRNA sequence transcribed from template: Amino acid sequence of peptide: Type of mutation:

6.c. Mutated DNA Template Strand #3: 3'-TACTGAC TGACTATC-5' Complementary DNA sequence: mRNA sequence transcribed from template: Amino acid sequence of peptide: Type of mutation: 6.d. Mutated DNA Template Strand #4: 3'-TAC GAC TGACTATC-5' Complementary DNA sequence: mRNA sequence transcribed from template: Amino acid sequence of peptide: Type of mutation:

Name: 6c and 6d ACGATC-5'. Envision that each is a section of a DNAmolecule
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 6c and 6d ACGATC-5'. Envision that each is a section of a DNAmolecule that has separated in preparation fortranscription, so you are only seeing the templatestrand. Construct the complementary DNA sequences(indicating 5' and 3' ends) for each mutated

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…
Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…
Part I. Structure-Function Relationships in Genes 1. Consider the "two-line model" of a gene shown below - each line represents one strand of a DNA double helix, and the transcription start site is indicated as +1. Use the two-line models provided when answering the following questions. 3' 5' +1 Assume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter min I • Draw a box where you would expect to find the TATA box • Draw a third line below the model representing the RNA transcript (label the ends!) • Label one of the DNA strands as the template strand 3' 2. Now, let's try that again! This time assume that you know RNA polymerase will move to the left during transcription. Repeat the same tasks as before on the diagram below: 5' 5' 3' +1 I I 5' 3'
Remember: for every DNA and RNA sequence you determine in this assignment, do not forget to indicate the 5' and 3' ends The following is the DNA template strand for a specific gene. The sequence does not include a promoter region or the terminator region. 3' | A|C|A| |GT|G|T|ATAA A A CC G|CGIIT TCTCC|AG|CT|T|G|C|G|G|G| G|G|A|T|T|G|C|G|C|A |A G CCAAA|G|ACAA|TAGG|ATACGTA |ATCTTT| 5' 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the MRNA primary transcript sequence 5' GGG AUG UCA CÁC AUA UUU 1 2 3 4 5 6
5'-GCGGTACGTTACGGCTTTACTGACCTGCAGGC-3' A. Convert this to a double strand DNA molecule by writing the complementary sequence. Be sure to correctly label the ends of the double stranded molecule B. Pick one of the two strands and write the sequence of an RNA molecule that could be transcribed from it. Again, you must correctly label the ends of the molecule.
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
www D le C 3⁰ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F) in the space provided 1. The name of this process is best known as Rho dependent termination 2. The enzyme C called DNA polymerase incorporates ribonucleotides into B called the mRNA False 3. The DNA region A contains inverted palindrome sequences which results in formation of a stem-loops structure 4. During this process, the structure D called terminating hairpin forms and increases the enzyme affinity which terminates transcription