A strictly fermentative bacterium produces ATP A. by glycolysis only. B. by photosynthesis only. O C. only in the absence of oxygen. D. only in the presence of oxygen. Clear my choice
Q: Question 23 All may be RNA polymerase Il promoter constituents EXCEPT: A the core element where…
A: Transcription is the process by which RNA is produced from the DNA template. This process occurs…
Q: In microscopy, what could be the possible reason why we cannot completely resolve the specimen under…
A: A microscope is a lab instrument used to examine the objects that are too small to be seen by the…
Q: Which statement is False? O B-D-glucose and B-D-galactose can be differentiated using NMR Epimers…
A: * NMR spectroscopy is used to study the physical and chemical and biological properties. *An NMR…
Q: Compare the cells in the two photomicrographs below in terms of their shape and structure(s). А B
A: *pictomicrographs shows the photograph of objects under a microscope. * objects like metal and…
Q: In goats, the gene for coat color is on an autosome and light brown color is dominant to black. A…
A: Let the gene determining the same be B/b So light brown male is BB Dark brown female is bb BBX bb Bb…
Q: Diagram a translocation arising from repetitive DNA.Repeat for a deletion.
A: Changes in the structure of chromosomes may create issues with the body's systems' development,…
Q: The fact that some eukaryotic rRNAs are self-splicing indicates that A RNA structures are highly…
A: In eukaryotes, rRNA have a sigma factor which makes the self splicable and hence the highly variable…
Q: Describe the difference between the nerve and muscle in response to increasing stimulus voltage.
A: Introduction A nerve is a cable-like structure within the body composed of neurons that uses…
Q: Which of the stated relationships is correct? A. the heart is inferior to the clavicle B. the…
A: Introduction Proximal means close to or near the trunk or the origin of a part (example, the…
Q: Members of Suliformes typically lay 2-3 eggs, but it is rare that more than one nestling survives.…
A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…
Q: Which is a common cause for the production of oncogenes? a. defective ion channel proteins…
A: Cancer The continuous uncontrollable division of defective cell can leads to the cancer.
Q: I understand how nuclear factor-kB (NFKB) works in the inflammatory response but what is the…
A: Inflammation has long been considered a marker for cancer cells and it plays a crucial role in the…
Q: A patient has just been brought into the Accident and Emergency (A&E) department of the local…
A: The stock solutions can be diluted to achieve the desired concentration. The calculations are based…
Q: 7. RSV is a abiotic stress in plants. 8. RSV produced in the root system of plants improves the…
A: Here I discuss about RSV and their role in plants according to fill in the blank question given.
Q: 13) Draw a graph representing the changes in membrane potential across the axonal membrane before,…
A: The electric signals that flow down the dendrites to form a nerve impulse or an action potential are…
Q: . What is Ringworm? What are the different types of ringworm?
A: Ringworm is A highly contagious fungal infection of the skin or scalp. Ringworm is spread by…
Q: The two figures on the left are the plant leaf cell viewed under the high power objective (HPO).…
A:
Q: The normal sequence of nine genes on a certainDrosophila chromosome is 123 • 456789, where the…
A: The basic karyotype of Drosophila melanogaster, which is observed mitotically comprises active…
Q: The subunit in E. coli RNA polymerase which is required for recognition of the promoter sequence is…
A: Transcription is a process by which an RNA copy of the DNA is made. It is an important step in gene…
Q: A 3-point test cross produces the following numbers of offspring: + + a 348 How many double…
A: Test cross is a cross made between f1 (offspring)with its recessive parent to identify the dominance…
Q: Match the column I with column II and select the correct option. Column- Column- II a. Ovule (i)…
A: Ovary is an organ in the female reproductive system of both plants and animals. It is the organ in…
Q: Question 13 Which of the following can determine location of glysosidic linkages? O Polarimetric…
A: LC-MS/MS-based method for the rapid and simultaneous relative quantitation of glycosidic linkages…
Q: Which of the following helps Human sperm with locomotion? a) Flagellum b) Basal body c) Nucleosome…
A: *Sperm is male reproductive gamete that produce motile sperm with a tail called as flagellum…
Q: Organisms that produce offspring that always look like the parents are said to be: O Purebred/Pure…
A: Organisms that produce offsprings that always look like the parents are said to be.
Q: what is bacillus megaterium? must be in essay form.
A: Microbes are minute living creatures that must be identified with specialized scientific equipment…
Q: using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…
A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…
Q: 1. Infections caused may fall into one of four categories which vary depending on the site affected…
A: Infections It is defined as the invasion of organism's body cells by disease causing pathogens.…
Q: A beneficial dominant mutation is expected to take fewer generations to reach high frequency than a…
A: There are few important points: A population genetics is the study of changes in the frequencies of…
Q: Which choice besi describes the location of the majority of the musculo-skeletal system? A. It is in…
A: Introduction Musculoskeletal system:- It is made up of the body's bones (the skeleton), joints,…
Q: Optimal DNA replication requires the coordinated effort of all the following EXCEPT: A single strand…
A: Single stranded binding proteins prevent single stranded DNA from exonuclease activity during…
Q: 7. RSV is a and as generated during times of biotic and m. abiotic stress in plants. 8. RSV produced…
A: Solution :- Stage 1 Here I examine about RSV and their job in plants as indicated by fill in the…
Q: Match the force for evolution with its description, definition or example. This force typically…
A: Introduction Evolution is the process of a species' features changing over numerous generations…
Q: How many copies of succinate dehydrogenase are found in a respirasome?
A: Respirasome, as a vital part of the oxidative phosphorylation system, undertakes the task of…
Q: Which of the following is the most accurate statement regarding the problem with using life…
A: Option 3 Life expectancy give you average of country but significant differences within groups of…
Q: Can two normal individuals of the same species with sexual reproduction have identical genomes and…
A: The karyotype of an organism depicts the arrangements of its chromosomes. It is used to demonstrate…
Q: Microorganism A was exposed to different constant temperatures to get the specific D- values.…
A: The z-value is a measure of the change of the D-value with varying temperature, and is a simplified…
Q: Construct a comparative matrix on different sterilization methods.
A: In our enterprise groups, it’s vital to have an expansion of sterilization methods so that you can…
Q: Question 3 What are the diseases associated with hypocomplementaemia and which complement deficiency…
A: Hypocomplementaemia is the disease of the immune system in which the amount of the complement…
Q: Define the words phylogeny, phylogenetic tree and systematics
A:
Q: Which of the following Is true of the leading strand? A it is synthesized discontinuously at the…
A: Leading strand is synthesized continuously and lagging strand is synthesized discontinuously. Both…
Q: What is the World Health Organization recommendation for the prophylaxis of rheumatic fever after a…
A: Introduction - When strep throat or scarlet fever isn't treated appropriately, rheumatic fever might…
Q: Question 44 The term RNA refers to RNA. Blank 1 Blank 1 Add your answer
A: INTRODUCTION Answer to the question 44 is given below.
Q: 3. Describe the allosteric regulation of allosteric activation of the a-ketoglutarate dehydrogenase…
A: *Allosteric regulation is the regulation of an enzyme by binding effector molecule other than the…
Q: Task 2 Week 15 4. FIGURE 4 shows sugar transport in phloem. Phloem A В 888 Source cell $8888 Sink…
A: Introduction The movement of materials across cell membranes is referred to as cell transport.…
Q: Which of the following does NOT tend to promote genetic divergence between populations? a)…
A: The genetic diversity has three different sources: mutation, recombination and immigration of genes.
Q: During the glucose oxidation, oxygen (O,) is used to oxidize glucose into CO, and water. What are…
A: Glycolysis is step one in the breakdown of glucose to extract electricity for mobile metabolism.…
Q: List two possible missense mutation effects on the new polypeptide.
A: *missense mutation occurs when there is change in a single base pair that causes substitution of…
Q: Q4.5. Why do neurons generate an action potential, instead of simply relying on the opening of ion…
A:
Q: An enzyme that acts as both a kinase and phosphatase in rxn. of 1 uM 1,3-bisphosphoglycerate,…
A: An enzyme that adds phosphate groups (PO43) to other molecules is known as kinase. Kinases are…
Q: Conservation of developmental genes in evolution is supported by all of the observations except that…
A: INTRODUCTION A homeotic gene is a collection of genes that manage the pattern of body formation…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Most oxidation reactions in microbial bioenergetics involve thea. removal of electrons b. addition of electrons c. addition of oxygen d. removal of oxygenChopped garlic often contains C. botulinum endospores and iscommonly sold submerged in olive oil, which creates an anaerobicenvironment. What is required to be added to garlic sold in thismanner?a. sodium chlorideb. citric acidc. waterd. A warning label describing the symptoms of botulism.These are enzymes that can sustain in a high hydrostatic pressure. * (Please choose one correct answer only) A. Piezohiles B. Halophiles C. Acidophiles D. Alkaliphiles E. Thermophiles
- In "Fermentation by Yeast" experiment, we aremeasuring the height of gas accumulation. Whatgas is it? A.002B. 0 c02C. OcD. 0 H2E.Water vapor The color of bromothymol blue in "AerobicRespiration in Beans" experiment was changingbecause soaked beans started to perform A.alcohol fermentationB.lactic acid fermentationC.cellular respirationD.photosynthesisThese enzymes require a temperature of 15 degree Celsius or lower needed for growth / optimal activity. * (Please choose one correct answer only) A. Thermophiles B. Cryophiles C. Halophiles D. Piezophiles2. An aerotolerant bacterium usually generates which of the following enzymes to detoxify reactive oxygen species? a. Superoxide dismutase b. Catalase c. Superoxide dismutase and Catalase d. Cytochrome c oxidase e. Nitrite reductase Your Explanation:
- Which of the following statements is false? A. Sulfur-oxidizing bacteria may form hydrogen sulfide (H2S) as a product of the oxidation. B. Dissimilatory reduction of metals such as Fe3+ to Fe2+ represents anaerobic respiration. C. The nitrification reactions carried out by certain bacteria would be considered lithotrophy. D. Denitrification reactions would be considered anaerobic respiration.For the electron transport chain, all are inhibitors except: Select one: O a. Antimycin A O b. fluoroacetate Oc. Amytal O d. NaN2Which of the statements is NOT TRUE about anaerobic respiration and fermentation? a. Anaerobic respiration has greater ATP output than fermentation. b. Both anaerobic respiration and fermentation does not require oxygen. c. Both anaerobic respiration and fermentation establish chemiosmotic gradients. d. Anaerobic respiration predominantly characterized by complete oxidation of substrate.
- 1. You set up two cultures with an equal amounts of Escherichia coli. You label one culture "A" and the other "B." Each culture is given 100mL of tryptic soy nutrient broth. You then take culture A and incubate it in the absence of oxygen and take culture B and incubate it in the presence of oxygen for one week. If E. coli is able to use both aerobic and anaerobic metabolism, the how would we classify it? Is it an obligate aerobe, obligate anaerobe, or a facultative anaerobe? Based on that information, which flask, A or B, would have more cells at the end of the week? Fully explain your answer.Yeast is a facultative anaerobe. This means that alcohol fermentation takes place only if: a. the temperature is close to 37°C b. the atmosphere does not contain oxygen c. sugar is provided to the cells d. light is provided to the cells1. On your groupmate's DCC plate, you can see mucoid bacterial colonies with clearings underneath. What all can they conclude based only on the DCC test? Select all that apply. a. The bacteria ferments glucose. b. The bacteria produces acid byproducts from fermentation. c. The bacteria can aerobically respire. d. The bacteria does not produce gas byproducts..